Tải bản đầy đủ

xây dựng quy trình định danh vi khuẩn gây bệnh loét trên cây bưởi bằng phương pháp sinh học

i
BỘ GIÁO DỤC VÀ ĐÀO TẠO
TRƢỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH
BỘ MÔN CÔNG NGHỆ SINH HỌC









TRẦN THỊ MINH TÚ



XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN
GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG
PHƢƠNG PHÁP SINH HỌC PHÂN TỬ





LUẬN VĂN KỸ SƢ
CHUYÊN NGÀNH CÔNG NGHỆ SINH HỌC










Thành phố Hồ Chí Minh
Tháng 9/2006
ii
BỘ GIÁO DỤC VÀ ĐÀO TẠO
TRƢỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH
BỘ MÔN CÔNG NGHỆ SINH HỌC











XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN
GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG
PHƢƠNG PHÁP SINH HỌC PHÂN TỬ




LUẬN VĂN KỸ SƢ
CHUYÊN NGÀNH CÔNG NGHỆ SINH HỌC


Giáo viên hƣớng dẫn Sinh viên thực hiện
TS. LÊ ĐÌNH ĐÔN TRẦN THỊ MINH TÚ
KHÓA: 2002 - 2006







Thành phố Hồ Chí Minh
Tháng 9/2006
iii
MINISTRY OF EDUCATION AND TRAINING
NONG LAM UNIVERSITY, HCMC
FACULTY OF BIOTECHNOLOGY









AMPLIFICATION MOLECULAR ENGINEERING
TO IDENTY CITRUS CANKER BACTERIA



GRADUATION THESIS
MAJOR: BIOTECHNOLOGY




Professor Student
Dr. LE DINH DON TRAN THI MINH TU
TERM: 2002 - 2006










HCMC, 09/2006





iii
LỜI CẢM ƠN
Xin chân thành cảm ơn:
- Ban Giám Hiệu trƣờng Đại học Nông Lâm Tp. Hồ Chí Minh đã tạo mọi điều
kiện cho tôi trong suốt thời gian học tập tại trƣờng.
- Các thầy cô trong Bộ môn Công nghệ sinh học cùng các thầy cô trực tiếp giảng
dạy luôn tận tình hƣớng dẫn, giảng dạy, giúp đỡ và động viên tôi trong suốt bốn
năm qua.
- TS. Lê Đình Đôn đã tận tình hƣớng dẫn và động viên tôi trong thời gian thực
hiện đề tài tốt nghiệp.
- TS. Bùi Minh Trí và anh Nguyễn Văn Lẫm và các anh chị phụ trách phòng Hóa
Sinh thuộc Trung tâm Phân Tích Thí Nghiệm Đại học Nông Lâm Tp. HCM đã
tận tình giúp đỡ tôi trong thời gian làm đề tài.
- Toàn thể lớp CNSH 28 đã hỗ trợ, giúp đỡ và động viên tôi trong suốt thời gian
làm đề tài.
Thành kính ghi ơn ông bà, cha mẹ đã nuôi nấng, dạy bảo con đƣợc nhƣ ngày hôm nay,
cùng những ngƣời thân trong gia đình luôn tạo mọi điều kiện và động viên con trong
suốt quá trình học tập tại trƣờng.
Chân thành cảm ơn.
Tp. HCM, tháng 08 năm 2006

Sinh viên
Trần Thị Minh Tú





iv
TÓM TẮT
TRẦN THỊ MINH TÚ, Đại học Nông Lâm Tp. Hồ Chí Minh. Tháng 8/2006. “XÂY
DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY
BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ”.

Giáo viên hƣớng dẫn:
TS. LÊ ĐÌNH ĐÔN
Đề tài đƣợc thực hiện trên đối tƣợng là vi khuẩn Xanthomonas spp. Đây là vi
khẩn có khả năng gây bệnh trên nhiều cây trồng khác nhau, ảnh hƣởng rất lớn đến
năng suất của cây trồng. Chúng tôi sử dụng các kỹ thuật nông học, phƣơng pháp sinh
học phân tử nhằm định danh dòng Xanthomonas sp gây bệnh loét trên cây bƣởi mục
tiêu hiểu rõ bản chất sinh học của dòng gây bệnh, để dễ dàng cho việc đƣa ra các biện
pháp phòng trừ bệnh do vi khuẩn này gây ra. Đề tài đƣợc thực hiện tại phòng thực tập
Bệnh cây khoa Nông Học và Trung tâm Phân Tích Thí Nghiệm trƣờng Đại học Nông
Lâm, Tp. Hồ Chí Minh, từ 06/02/06 đến 06/08/06.
Nội dung nghiên cứu:
1. Phân lập, nuôi cấy, xác định gram, quan sát hình thái trên môi trƣờng PGA, YDC.
2. Chủng bệnh nhân tạo để kiểm tra lại triệu chứng gây bệnh của dòng vi khuẩn
phân lập đƣợc.
3. Thực hiện sắc ký bản mỏng dựa vào sắc tố đặc trƣng để nhận Xanthomonas sp. .
4. Tiến hành nhân sinh khối, ly trích DNA tổng số.
5. Thực hiện phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và
Xan332.
6. Thực hiện phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và
XACF cho phép xác định nhanh Xanthomonas axonopodis pv. citri.








v
Kết quả đạt đƣợc:
1. Phân lập đƣợc 4 dòng vi khuẩn, tất cả là gram âm, trên môi trƣờng YDC phân
thành 2 nhóm vàng sữa và vàng chanh..
2. Tất cả 4 dòng phân lập đƣợc đều tạo vết thƣơng sau khi chủng bệnh nhân tạo,
triệu chứng bệnh có khác nhau.
3. Kết quả sắc ký có 1 dòng (XBDL1) có sắc tố phát sáng rõ sau khi chụp UV.
4. Thực hiện thành công phản ứng PCR trên 16s-23s rDNA ITS với cặp primer
Xan1330 và Xan332 cho sản phẩm 1,1 kb.
5. Không thực hiện đƣợc phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên
biệt XACR và XACF.























vi
MỤC LỤC
TRANG
Trang bìa
Trang tựa
Lời cảm ơn ............................................................................................................. iii
Tóm tắt ................................................................................................................... iv
Mục lục .................................................................................................................. v
Danh sách các hình ................................................................................................ viii
Danh sách các bảng ............................................................................................... ix
Danh sách các chữ viết tắt ..................................................................................... xi
Phần 1. GIỚI THIỆU .......................................................................................... 1
1.1. Đặt vấn đề ...................................................................................................... 1
1.2. Mục đích ......................................................................................................... 1
1.3. Yêu cầu ........................................................................................................... 2
1.4. Giới hạn của đề tài ......................................................................................... 2

Phần 2. TỔNG QUAN ......................................................................................... 3
2.1. Sơ lƣợc về nhóm cây có múi trên thế giới và trong nƣớc ............................. 3
2.1.1. Nguồn gốc và phân loại cây bƣởi ................................................................ 3
2.1.2. Giá trị cây ăn quả có múi ở thế giới và trong nƣớc .................................... 3
2.1.3. Tình hình sản xuất cam quýt ở Việt Nam ................................................... 4
2.1.4. Tình hình sản xuất cam quýt trên thế giới .................................................. 4
2.2. Bệnh loét cam Xanthomonas citri (Hasse-Dowson) ..................................... 5
2.2.1. Triệu chứng bệnh ....................................................................................... 5
2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri) ........... 7
2.3. Sơ lƣợc vùng rDNA-ITS ................................................................................ 8





vii
2.3.1. Giới thiệu vùng rDNA ................................................................................. 8
2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp. ................................................... 9
2.4. Sơ lƣợc về hrpW gen ..................................................................................... 9
2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam ................... 11
2.5.1. Trên Thế Giới ............................................................................................. 11
2.5.2. Tại Việt Nam ............................................................................................. 12
2.6. Quy trình định danh Xanthomona sp. . .......................................................... 12
2.6.1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp
nuôi cấy, thực hiện phản ứng sinh hóa ................................................................. 12
2.6.2 Quy trình định danh theo phƣơng pháp phân tử .......................................... 13
2.7 Phƣơng pháp PCR .......................................................................................... 13
Phần 3. VẬT LIỆU VÀ PHƢƠNG PHÁP ....................................................... 16
3.1. Thời gian và địa điểm nghiên cứu ................................................................. 16
3.2. Nội dung nghiên cứu ..................................................................................... 16
3.3 Vật liệu nghiên cứu ......................................................................................... 16
3.4. Phƣơng pháp tiến hành .................................................................................. 17
3.4.1 Phân lập, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định
Gram âm hay Gram dƣơng các dòng vi khuẩn gây bệnh loét trên cây bƣởi ........ 17
3.4.2. Chủng bệnh nhân tạo .................................................................................. 18
3.4.3. Thực hiện sắc ký bản mỏng định danh vi khuẩn ........................................ 18
3.4.4. Phƣơng pháp ly trích DNA tổng số của vi khuẩn ...................................... 20
3.4.5. Khuếch đại vùng 16s-23s rDNA ITS và vùng hrpW gen .......................... 21
3.4.5.1 Khuếch đại vùng 16s-23s rDNA ITS dòng vi khuẩn phân lập
với cặp mồi Xan1330 và Xan332 ......................................................................... 22
3.4.5.2 Khuếch đại đoạn hrpW gen dòng vi khuẩn phân lập
với cặp mồi XACF và XACR .............................................................................. 23
3.5.6. Điện di kiểm tra sản phẩm ly trích và sản phẩm PCR ................................ 23





viii
Phần 4. KẾT QUẢ VÀ THẢO LUẬN ............................................................... 25
4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở
cây bƣởi da láng và bƣởi đƣờng cam ................................................................... 25
4.2 Kết quả nuôi cấy vi khuẩn gây bệnh loét trên môi trƣờng PGA và YDC ...... 25
4.2. Chủng bệnh bệnh nhân tạo ............................................................................. 26
4.3. Sắc ký định danh vi khuẩn gây bệnh ............................................................ 28
4.4 Ly trích DNA tổng số .................................................................................... 28
4.5. Thực hiện PCR với cặp mồi Xan1330 và Xan 332 trên vùng ITS ................ 29
4.6 Thực hiện PCR với cặp mồi XACR và XACF trên hrpW gen ...................... 29
Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ ................................................................... 32
5.1. Kết luận .......................................................................................................... 32
5.2. Đề nghị ......................................................................................................... 32
Phần 6.TÀI LIỆU THAM KHẢO ...................................................................... 33
Phần 7. PHỤ LỤC ............................................................................................... 35

















ix
DANH SÁCH CÁC HÌNH

Hình Trang
Hình 2.1. Triệu chứng bệnh loét trên lá bƣởi Da Láng .................................................. 6
Hình 2.2. Triệu chứng bệnh loét trên trái bƣởi Da Láng ............................................... 6
Hình 2.3. Triệu chứng bệnh loét trên cành bƣởi Da Láng ............................................. 7
Hình 2.4. Cấu trúc vùng 16s-23s rDNA ITS trên Xanthomonas ssp ........................... 10
Hình 2.5. Sơ đồ hình cây thể hiện mối tƣơng quan giữa các dòng Xanthomonas ssp.
dựa trên vùng 16s-23s rDNA ITS ................................................................................ 10
Hình 3.1(a) Tấm sắc ký vừa nhỏ dung dịch sắc tố ..................................................... 19
Hình 3.1(b). Tấm sắc ký ngâm methanol trong bình hút ẩm ...................................... 19
Hình 4.1. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng PGA
nhiệt độ 28
o
C ................................................................................................................ 25
Hình 4.2. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng YDC ở
nhiệt độ 28
o
C ................................................................................................................ 26
Hình 4.3. Các triệu chứng bệnh sau khi chủng bốn dòng phân lập đƣợc trên lá non
bƣởi Da Láng quan sát dƣới kính hiển vi độ phóng đai 4x10 lần ............................... 27
Hình 4.4. Kết quả sắc ký trƣớc ................................................................................... 28
Hình 4.5. DNA tổng số ly trích theo quy trình 3.2.4.4 ............................................... 29
Hình 4.6. Kết quả diện di sản phẩm PCR đoạn 16s-23s rDNA ITS với cặp mồi
Xan1330 và Xan332 ..................................................................................................... 29
Hình 4.7. Sơ đồ các bƣớc cơ bản định danh vi khuẩn gây bệnh loét trên cây bƣởi theo
phƣơng pháp sinh học phân tử...................................................................................... 31









x
DANH SÁCH CÁC BẢNG

Bảng Trang
Bảng 2.1. Môi trƣờng phân lập một số loài X. campestis ............................................. 14
Bảng 2.2. Đặc tính sinh hóa Xanthomonas sp. ............................................................. 14
Bảng 3.3.Thành phần dung dịch đệm TE...................................................................... 20
Bảng 3.2. Thành phần phản ứng PCR với cặp mồiXan1330 và Xan332 .................... 22
Bảng 3.3. Chu trình nhiệt phản ứng PCR với cặp mồi Xan1330 và Xan332 .............. 22
Bảng 3.4 Thành phần phản ứng PCR với cặp mồi XACF và XACR ........................... 23
Bảng 3.5. Chu trình nhiệt phản ứng với cặp mồi XACF và XACR ............................. 23
Bảng 4.2. Hình thái vi khuẩn đƣợc phân lập từ bƣởi Da Láng
và bƣởi Đƣờng Cam ..................................................................................................... 25
Bảng 4.3. Khả năng nhiễm bệnh của 4 dòng
XBDL1, XBDL2, XBDL3, XBĐC3 ........................................................................... 27










xi
DANH SÁCH CÁC CHỮ VIẾT TẮT

ITS : Internal Transcribed Spacer – vùng dịch mã trong nhân
DNA : Deoxyribonucleotide Acid
rDNA : ribosome DNA
PCR : Polymerase chain reaction – phản ứng chuỗi Polymerase
PGA : Potato Glucose Agar
STT : Số thứ tự
ng : nano gram
µM : micro mol
TE : Tris EDTA
µg : micro gram
µl : micro lit
TAE : Tris Acetic EDTA
bp : base pair
dNTP : deoxyribonucleotide triphosphate
ISGs : intraspecific groups
SDS : sodium dodecyl sulfate
EDTA : ethylenediamine – tetraacetic acid
IGS : intergenic spacer





1




Phần 1. GIỚI THIỆU
1.1. Đặt vấn đề
Nƣớc ta nằm trong vùng khí hậu nhiệt đới gió mùa rất thuận lợi cho nhiều loại
cây nhiệt đới phát triển. Đặc biệt các loại cây ăn quả rất đa dạng và phong phú về
chủng loại. Trong đó bƣởi (Citrus grandis L Rutaceae) là loại cây ăn quả thuộc nhóm
cây có múi đƣợc trồng phổ biến và lâu đời tại các vùng đông Nam Bộ với các vùng
trồng bƣởi lâu đời và nổi tiếng nhƣ Vĩnh Cửu (Đồng Nai), Tân Uyên (Bình Dƣơng).
Cây bƣởi có tuổi thọ lâu hơn các loại cây có múi khác, thời gian bảo quản cũng lâu
hơn. Bƣởi còn là loại quả giàu vitamin đƣợc thị trƣờng trong nƣớc cũng nhƣ ngoài
nƣớc ƣa chuộng về hƣơng vị cũng nhƣ dinh dƣỡng nên ngƣời trồng bƣởi có thu nhập
cao và ổn định hơn so với các loại cây nông nghiệp khác. Vì vậy, cây bƣởi đã góp
phần cải thiện và nâng cao đời sống của ngƣời dân.
Tuy nhiên cho đến nay diện tích trồng bƣởi không tăng. Mặt khác, giống bƣởi
năng suất và phẩm chất rất tốt là cây Bƣởi Đƣờng Da Láng lại giảm rõ rệt. Nguyên
nhân chính là do bị nhiễm bệnh nghiêm trọng do vi khuẩn Xanthomonas sp. gây nên.
Vi khuẩn không ảnh hƣởng nhiều đến chất lƣợng quả nhƣng gây nên những vết sần sùi
trên mặt trái làm mất vẻ thẩm mỹ nên rất khó tiêu thụ trên thị trƣờng. Ngoài ra, vi
khuẩn còn gây bệnh trên cành, lá làm ảnh hƣởng đến sự sinh trƣởng và phát triển của
cây. Không chỉ gây hại trên cây bƣởi mà vi khuẩn Xanthomonas sp. gây hại hầu hết
các loại cây có múi từ mức độ nhẹ đến nặng.
Để xác định rõ dòng vi khuẩn gây bệnh này chúng tôi thực hiện đề tài “Xây
dựng quy trình định danh vi khuẩn gây bệnh loét trên cây bƣởi bằng phƣơng
pháp sinh học phân tử”. Từ đó, chúng tôi có thể tìm ra phƣơng pháp phòng và trị
bệnh đạt hiệu quả nhằm khôi phục lại giống bƣởi Đƣờng Da Láng mang lại hiệu quả
kinh tế cao.
1.2. Mục đích
- Xây dựng quy trình định danh vi khuẩn gây bệnh loét trên cây có muối (cây
bƣởi).
- Phân loại tính độc của chủng gây bệnh.
2




1.3. Yêu cầu
- Thành thạo các thao tác phân lập, nuôi cấy, chủng bệnh nhân tạo trong phòng
thí nghiệm.
- Thực hiện đƣợc phƣơng pháp sắc ký bản mỏng định danh vi khuẩn.
- Thành thạo phƣơng pháp ly trích DNA vi khuẩn.
- Tính toán, thiết lập đƣợc phản ứng PCR, hạn chế tối đa tạp nhiễm.
1.4. Giới hạn của đề tài
- Chỉ xác định đƣợc chủng vi khuẩn gây bệnh loét trên cây bƣởi Da Láng,
bƣởi Đƣờng Cam là Xanthomonas sp.
- Chƣa giải đƣợc trình tự sản phẩm PCR đoạn 16s-23s rDNA ITS, chƣa thực
hiện đƣợc phản ứng PCR trên hrpW để định danh chính xác chủng vi khuẩn
gây bệnh ở mức độ loài.















3




Phần 2. TỔNG QUAN
2.1. Sơ lƣợc về nhóm cây có múi trên thế giới và trong nƣớc
2.1.1. Nguồn gốc và phân loại cây bƣởi
Cây có múi hiện đang trồng ở nhiều nƣớc trên thế giới đều có nguồn gốc từ các
nƣớc vùng nhiệt đới và cận nhiệt đới Đông Nam Á. Đƣờng ranh giới của vùng xuất xứ
cây ăn quả có múi nằm ở dãy chân núi Himalaya, phía đông Ấn Độ qua miền nam
Trung Quốc, về phía nam đƣờng ranh giới vùng đi qua Australia (theo Taraka, 1971).
Lịch sử trồng cây có múi ở nƣớc ta xuất hiện từ rất lâu đời cách đây 3000-4000
năm (Đƣờng Hồng Dật). Ngày nay, cây có múi đƣợc trồng trên khắp đất nƣớc ta từ
Lào Cai đến Cà Mau, từ Quảng Ninh đến Lai Châu. Đặt biệt là bƣởi với nhiều giống
đƣợc trồng ở nƣớc ta: bƣởi Da Láng, bƣởi Năm Roi, bƣởi Lông Cổ Cò, bƣởi Đƣờng
Cam, bƣởi Da Xanh, bƣởi Lông Hồng.Các vùng trồng bƣởi nổi tiếng ở nƣớc ta nhƣ
Đồng Nai và các tỉnh Đồng Bằng Sông Cửu Long.
2.1.2. Giá trị cây ăn quả có múi ở thế giới và trong nƣớc
Cây ăn quả có múi nhƣ cam, quýt, bƣởi là một trong những loại quả cao cấp
đƣợc nhiều ngƣời ƣa chuộng và đƣợc sản xuất ở nhiều nƣớc trên thế giới. Giá trị dinh
dƣỡng cây ăn quả có múi rất cao. Trong thành phần thịt quả có chứa 6-12% đƣờng,
chủ yếu là sacaroza. Hàm lƣợng vitamin C trong quả là 40-90% mg/100g tƣơi. Các
loại axit hữu cơ chứa trong thịt quả là 0,4-1,2%, trong đó có nhiều axit có hoạt tính
sinh học cao. Trong quả còn chứa các chất khoáng và dầu thơm. Tinh dầu đƣợc cất từ
vỏ quả, lá, hoa đƣợc dùng trong công nghiệp thực phẩm. Đặc biệt là chanh yên, một
tấn quả có thể đạt đƣợc 67 lít tinh dầu, tinh dầu ca quýt có giá trị khá cao trên thị
trƣờng quốc tế.
Ở nhiều nƣớc trên thế giới, từ những thời xa xƣa, ngƣời ta đã biết dùng các
thuộc chi Citrus làm thuốc chữa bệnh. Ở thế kỷ thứ XVI, các thầy thuốc Trung Quốc,
Ấn Độ đã dùng quả cam quýt để phòng ngừa bệnh dịch hạch, chữa trị bệnh phổi và
bệnh chảy máu dƣới da.
Ở nƣớc ta ngƣời dân đã dùng cây, lá, hoa, quả các loại cây ăn có múi để phòng
và chữa bệnh từ thời xa xƣa. Lê Quý Đôn vết trong sách “ Vân đài loại ngữ” “Quýt
4




vàng là thƣợng phẩm, quýt đỏ, quýt vá, quýt cát là hạ phẩn, vỏ quýt có tính khoan
trung hạ khí”, vỏ quýt có tên dƣợc liệu là “ trần bì” đƣợc sử dụng nhiều trong một số
bài thuốc y học cổ truyền.
Giá trị kinh tế, cây ăn quả có múi là cây lâu năm chóng cho thu hoạch, cây cam
quýt có thể sống và chóng cho thu hoạch quả trong vòng 25-30 năm vẫn cho năng suất
cao, đạt từ 100-250 kg quả/1cây trong một vụ.(Đƣờng Hồng Dật, 2000).
2.1.3. Tình hình sản xuất cam quýt ở Việt Nam
Theo thống kê của ngành nông nghiệp thì đến năm 1993 diện tích trồng cam
quýt ở nƣớc ta là 27.640 ha, tăng hơn năm 1989 năm là trên 10.000 ha (năm 1989-
17.205ha). Những năm gần đây diện tích trồng cam quýt ở một số nơi, nhất là ở một số
tỉnh ĐBSCL tăng nhiều, trong khi một số tỉnh miền trung nhƣ Nghệ An, Hà Tỉnh,
Quảng Bình, diện tích trồng cam quýt bị giảm xuống, năm 1999 cả nƣớc có vào
khoảng trên dƣới 30.000 ha.
Sản lƣợng cam quýt ở nƣớc ta năm 1993 đƣợc thống kê là 163.778 tấn, tăng
khoảng 63.000 tấn so với năm 1989 (100.998 tấn). Năm 1999 ƣớc tính sản lƣợng cây
có múi trong cả nƣớc là 300.000 tấn.
Điều kiện đất đai và khí hậu nƣớc ta phù hợp cho phát triển cây ăn quả có múi.
Tuy nhiên, quá trình tăng chậm và quá trình phát triển cây ăn quả có múi diễn biến thất
thƣờng ở từng vùng sản xuất. Ở một số vùng trồng cam nổi tiếng trƣớc đây nhƣ vùng
cam Bố Hạ (Bắc Giang), vùng cam Xã Đoài (Nghệ An), không những diện tích không
tăng lên mà còn giảm xuống. (theo Đƣờng Hồng Dật, 2000).
Năm 1995, diện tích trồng cây ăn quả trong cả nƣớc là 346.400 ha trong đó
ĐBSCL 175.000 ha (50,7%), trung du miền núi Bắc Bộ 47.600 ha (13,7%), ĐBSH
33.800 ha (9,8%), miền Đông Nam Bộ 32.700 ha (9,5%), khu IV cũ 27.400 (7,9%),
duyên hải miền Trung 20.600 ha (6,9%), Tây Nguyên 8.600 ha (2,5%).
Theo Tổng cục thống kê năm 1996, vùng ĐBSCL đứng đầu về sản lƣợng cũng
đứng hàng đầu chiếm tỷ trọng 49, 05%. (Trần Thế Tục, 1998).
2.1.4. Tình hình sản xuất cam quýt trên thế giới
Trong những năm nửa sau thế kỷ XX, sản xuất cam quýt trên thế giới tăng
nhanh. Theo tài liệu của Tổ chức lƣơng thực và nông nghiệp của Liên hợp quốc (FAO)
5




trong vòng 20 năm (từ năm 1975 đến năm 1995), sản lƣợng cam quýt trên thế giới
tăng từ 22 triệu tấn lên đến 48 triệu tấn, tăng cao nhất là cam, quýt đỏ rồi đến chanh
yên, bƣởi chùm và chanh. Trong vòng 15 năm tính từ năm 1970 đến năm 1984, sản
lƣợng cam tăng bình quân là 51%, quýt 7,5%, chanh 4,7%, bƣởi chùm là 4,3%/ năm.
Tổng sản lƣợng cam quýt trên thế giới trong những thập niên 90 của thế kỷ XX bình
quân hàng năm là 60-70 triệu tấn với tổng diện tích là 2,5 triệu ha, tập trung ở các
nƣớc có khí hậu á nhiệt đới và một phần nhiệt đới ở các vĩ độ cao hơn 20-22
o
C bắc và
nam bán cầu.
Hiện nay có 75 nƣớc trồng cam quýt trên thế giới đƣợc chia thành 4 khu vực :
Châu Mỹ, các nƣớc Địa Trung Hải, các nƣớc Châu Phi và các nƣớc Châu Á. Những
nƣớc trồng nhiều cam quýt nhất là Mỹ 9,6 triệu tấn /năm, Braxin 7,2 triệu tấn/ năm,
Tây Ban Nha 1,7 triệu tấn / năm.
Nhật Bản cung cấp10% sản lƣợng cam quýt trên thế giới với 2,7 triệu tấn vào
những năm 20 của thế kỷ XX, trong đó chủ yếu là quýt Unshiu, loại quýt này chiếm
49,2% tổng sản lƣợng quả cam quýt của Nhật. (Đƣờng Hồng Dật, 2000).
Thống kê năm 1967 của FAO cho biết tổng sản lƣợng về trái có múi là
28.902.000 tấn, trong đó cam và quýt chiếm 23.434.000 tấn tức 81% và bƣởi (cộng với
bƣởi chùm ) chỉ có 2.286.000 tấn tức 7,9% chƣa bằng 1/10 cam, quýt. Dẫn chứng là
Mỹ chỉ sản xuất bƣởi chùm (Citrus paradis ), không sản xuất bƣởi (Citrus grandis) đã
chiếm tới 1.161.000 tấn tức 70,7% tổng số bƣởi và bƣởi chùm. Trong khi cả châu Á
trong đó có hai nƣớc lớn nhất là Ấn Độ và Philippin, trong cả bƣởi và bƣởi chùm chỉ
sản xuất 59.000 tấn tức 2,6%. Hiện nay, sản lƣợng trái có múi cả thế giới đã vƣợt quá
50 triệu tấn, gần gấp đôi năm 1967, song tỷ lệ trên đây không thay đổi nhiều và phần
của bƣởi còn thấp hơn nữa.(Vũ Công Hậu, 1996).
2.2. Bệnh loét cam Xanthomonas citri (Hasse-Dowson)
2.2.1. Triệu chứng bệnh
Bệnh loét hại cam quýt ở tất cả các bộ phận của cây trên mặt đất, làm rụng lá,
quả, cây cằn cọc chóng bị tàn. Ở vƣờn ƣơm, khi bị bệnh nặng cây con dễ chết. Quả bị
bệnh có phẩm chất kém không thể xuất khẩu và cất trữ đƣợc. Nhiều nƣớc trồng cam,
quýt trên thế giới đã cấm nhập những cây, mắt ghép, quả bị bệnh. Bệnh phá hoại ở
6




nhiều nƣớc và đã phát triển thành dịch ở khắp vùng châu Á nhiệt đới-Thái Bình
Dƣơng. Bệnh còn thấy ở các nƣớc châu Mỹ, châu Phi. Ở nƣớc ta bệnh hầu nhƣ phá hại
ở tất cả các vùng trồng cam quýt, gây thiệt hại đáng kể làm ảnh hƣởng tới nguồn hàng
xuất khẩu và tiêu dùng trong nƣớc.
Bệnh thƣờng bắt đầu xuất hiện ở lá non. Ban đầu vết bệnh là những chấm nhỏ
có đƣờng kính dƣới 1mm màu trắng vàng thƣờng thấy ở mặt dƣới lá. Sau đó vết bệnh
mở rộng hơn phá vỡ biểu bì mặt dƣới lá. Xung quanh vết bệnh có vầng tròn dạng giọt
dầu màu nâu hoặc xanh tối. Sau 2-3 tuần vết bệnh phát triển thành loét hình tròn màu
nâu xám. Khi vết loét già hóa gỗ rắn lại hình dạng vẫn còn hoặc không định hình. Trên
cây bƣởi vết bệnh khoảng 8mm.







Ở quả vết bệnh cũng tƣơng tự nhƣ ở lá.Vết bệnh rắn xù xì màu nâu ở giữa lõm,
mép ngoài nổi gờ lên, ở giữa vết bệnh mô chết rạn nứt. Toàn thể chiều dày của vỏ quả
có thể bị loét nhƣng không bao giờ vết loét ăn sâu vào ruột quả, bệnh nặng có thể làm
cho quả biến dạng ít nhiều.






Hình 2.1 Triệu chứng bệnh loét
trên lá bƣởi Da Láng

Hình 2.2 Triệu chứng bệnh loét
trên trái bƣởi Da Láng


7




Ở cành vết bệnh cũng tƣơng tự nhƣ ở lá nhƣng sùi lên tƣơng đối rõ ràng, ở giữa
vết bệnh không lõm xuống hoặc lõm xuống không rõ rệt. Vết bệnh còn xuất hiện ở gai
cũng giống nhƣ ở cành cây.







.
2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri)
Vi khuẩn có hình gậy ngắn, kích thƣớc khoảng 1,5-2 x 0,5-0,75µm, hai đầu tròn
có một lông roi ở đầu, có thể nối liền thành chuỗi, có vỏ nhờn nhuộm gram âm, háo
khí. Độ dài genome khoảng 5 Mbp. Sinh trƣởng dễ dàng trên môi trƣờng agar –
glucose –peptone, khuẩn lạc hình tròn, sáng, bóng, màu vàng sáp.
Đặc trƣng để phân biệt vi khuẩn Xanthomonas sp. với loại vi khuẩn màu vàng khác
là nó có thể sinh trƣởng thành khuẩn lạc màu vàng sáp trên miếng lát cắt củ khoai tây.
Phạm vi nhiệt độ phát triển là 5-35
o
C, thích hợp 20-30
o
C. Ở nhiệt độ 52
o
C
trong10 phút vi khuẩn chết. Vi khuẩn phát triển và hoạt động trong phạm vi pH 6,1-
8,8, thích hợp ở pH 6,6. Vi khuẩn có khả năng chịu hạn ở nhiệt cao, trong điều kiện
phòng thí nghiệm có thể tồn tại 130 ngày. Bệnh loét cam, bƣởi là bệnh hại có tính
nhiệt đới, vi khuẩn gây bệnh phát triển thích hợp trong điều kiện nhiệt độ cao, ẩm ƣớt,
sức chống hạn và lạnh cao. Vi khuẩn tồn tại trong vết lá, cành bệnh từ năm này qua
năm khác.
Theo Wolf (1916) vi khuẩn bệnh loét cam có thể tồn tại qua đông trong đất,
nhƣng Pltier và Frederich lại cho rằng vi khuẩn không thể tồn tại qua đông ở trong đất
hoặc trong lá rụng. Lee (1920) và Fulton (1925) cho rằng vi khuẩn bệnh loét cam
không đấu tranh đƣợc với tập đoàn vi khuẩn khác nên dễ dàng chết trong đất. Loucks
Hình 2.3 Triệu chứng bệnh loét
trên cành bƣởi Da Láng


8




(1930) đã chứng minh rằng vi khuẩn ở trong đất không vô trùng chỉ sống đƣợc 6-13
ngày nhƣng trong đất vô trùng có thể tồn tại đƣợc 150 ngày. Theo Rao và Hingorant ở
đất vô trùng, vi khuẩn sống đƣợc 52 ngày còn ở đất không vô trùng chỉ sống đƣợc 17
ngày. Cũng từ hai tác giả trên thời gian sống của vi khuẩn ở những lá cây chết rụng
xuống đất khoảng 6 tháng. (Lê Lƣơng Tề và Vũ Triệu Mân, 1999).
Vào mùa mƣa trời ẩm ƣớt vi khuẩn từ trong vết bệnh cũ hoạt động, truyền
lan đi trong mƣa, gió hoặc côn trùng, chim. Vi khuẩn cũng có thể truyền dễ dàng
qua quần áo, nông cụ. Vi khuẩn rơi trên quả, lá, cành sẽ xâm nhập qua vết thƣơng,
khí khổng.
Đặc điểm xâm nhiễm gây bệnh: bệnh phát sinh do 3 yếu tố cơ bản tác động lẫn
nhau quyết định là “cây ký chủ- vi khuẩn gây bệnh-điều kiện ngoại cảnh môi trƣờng”
(Lê Lƣơng Tề và Vũ Triệu Mân, 1999).
Dựa triệu chứng bệnh và sự biến chủng của vi khuẩn có các loại bệnh loét sau:
- Loại Asiatic (Canker A), do Xanthomonas axonopodis pv.citri, bắt nguồn từ
châu Á, phân bố rộng, khả năng gây bệnh rất mạnh.
- Loại B, do Xanthomonas axonopodis pv. aurantifolii , bắt nguồn từ Nam Mỹ,
gây bệnh chủ yếu trên chanh nhỏ, cam chua, bƣởi.
- Loại C, cũng do Xanthomonasdis axonopodis pv. aurantifolii nhƣng gây bệnh
trên chanh nhỏ và cam chua.
- Loại A* đƣợc phát hiện ở Oman, Saudi Arabia, Iran và Idian chỉ gây bệnh trên
chanh. (http://en.wikipedia.org/wiki/Citrus_canker).
2.3. Sơ lƣợc vùng rDNA-ITS
2.3.1. Giới thiệu vùng rDNA
Những gen mã hóa rRNA đƣợc tìm thấy trong vùng rDNA. Sản phẩm của
những gen này (rRNA) kết hợp với những phân tử protein hình thành những ribosom
có chức năng tổng hợp protein. Gen rDNA 16S mã hóa một phân tử RNA hình thành
tiểu đơn vị ribosom nhỏ của vi khuẩn điển hình (thành phần protein của tế bào). Trình
tự của gen này thích hợp là một mô hình phổ biến để nghiên cứu sự tiến hóa và phân
loại vi khuẩn. Gene rDNA đƣợc tìm thấy ở hầu hết các dạng sống (ngoại trừ virus và
9




prion). Các thành phần của trình tự rDNA từ những sinh vật có quan hệ với nhau đƣợc
đánh dấu giống nhau. Điều này có nghĩa, trình tự của những sinh vật thân cận đã đƣợc
sắp xếp chính xác, làm cho những khác biệt dễ dàng để đánh giá. Điều đó cũng có
nghĩa là chỉ một vài nhóm primer PCR là cần thiết để khuếch đại gene rDNA từ bất cứ
loài vi khuẩn nào. Trình tự của rDNA 16S đã đƣợc xác định cho nhiều loài. Sự thật,
không có bất kỳ gen nào khác đặc trƣng cho nhiều loài nhƣ vậy.
Chiều dài và trình tự của những vùng ITS của rDNA đƣợc cho rằng là vùng tiến
hóa nhanh nhất và vì vậy có thể rất biến đổi. Những universal primer đƣợc thiết kế từ
những vùng bảo tồn nằm hai đầu vùng ITS và vùng ITS có kích thƣớc nhỏ (600 – 700
bp) dễ dàng đƣợc khuếch đại bởi vì số bản sao lớn (lên tới 30000 bản trong mỗi tế bào
(Dubouzet and Shinoda, 1999) của vùng lặp lại trên rDNA. Điều này làm cho vùng
ITS trở thành một đề tài đƣợc quan tâm cho việc nghiên cứu về sự tiến hóa và phát
sinh loài (Baldwin và ctv., 1995; Hershkovitz và ctv., 1996, 1999) cũng nhƣ các
nghiên cứu về địa lý sinh vật (biogeographic) (Baldwin, 1993; Suh và ctv., 1993;
Hsiao và ctv., 1994; Dubouzet và Shinoda, 1999). (Nguyễn Thị Tiến Sỹ, 2005).
2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp.
Phân tích mối quan hệ loài dựa trên vùng 16s-23s rDNA bằng cách thiết kế
cặp primer Xan1330 và Xan332 dựa trên vùng gen 16s-23s rDNA ở Xanthomonas
sp. Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 1,1 kb và đƣợc xác định là
Xanthomonas sp. (Edmilson R Gonealves và Yoko. B. Rosato, 2002). (Hình 2.3,
Hình 2.4)
2.4. Sơ lƣợc về hrpW gen
Sự tƣơng tác giữa ký sinh với ký chủ phụ thuộc vào hệ thống protein . Đặc biệt
đối với tƣơng tác vi khuẩn gram âm gây bệnh thực vật với cây ký chủ. Loại protein
này đƣợc mã hóa bởi hrp gen. Trên Xanthomonas axonopodis pv.citri ngƣời ta xác
định các loại hrp gen: hrpG, hpaA, hpaB, hrcV, hrpB1, hrpD6, hrpB2, hrcU, hrcW,
hrpB4, hrcN. Trên X. a. pv.citri các hrp gen này nằm thành cụm trừ hrpW. (Marcos
C. Alergria và ctv, 2004). Dựa vào đặc tính của hrp gen là đặc trƣng cho từng loài gây
bệnh nên ngƣời ta thiết kế primer chuyên biệt cho phản ứng PCR phát hiện nhanh,
10




chính xác loài gây bệnh. Phƣơng pháp phát hiện nhanh bằng primer chuyên biệt này
nhanh, chính xác hơn các phƣơng pháp nuôi cấy.

























Hình 2.5 Sơ đồ hình cây thể hiện mối tƣơng quan giữa các dòng
Xanthomonas sp. dựa trên vùng 16s-23s rDNA ITS (Edmilson R
Gonealves và ctv, 2002).




Hình 2.4. Cấu trúc vùng 16s-23s rDNA ITS của Xanthomonas sp.
Trình tự primer Xan1330 và Xan332 đƣợc thiết kế trên vùng 16s-23s
(Edmilson R Gonealves và ctv, 2002).
Xan 1330 5’GTTCCCGGGCCTTGTACACAC 3’
Xan 322 5’ GGTTCTTTTCACCTTTCCCTC 3’




11




Ngƣời ta dựa vào trình tự hrpW gen của X. a. pv. citri (Genbank Accession No.
AE008923) thiết kế cặp primer XACR, XACF chuyên biệt phát hiện nhanh chính nó.
Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 561 bp (Dong Suk Park và ctv, 2006)
XACR 5’CGTCGCAATACGATTGGAAC 3’
XACF 5’CGGAGGCATTGTCGAAGGAA 3’
2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam
2.5.1. Trên Thế Giới
Năm 2002, Edmilson R.Goncalves và ctv đã tiến hành phân tích mối quan hệ di
truyền giữa 17 loài Xanthomonas sp. bằng thực hiên phản ứng PCR và đọc trình tự
sản phẩm PCR.Phản ứng đƣợc thực hiện với cặp mồi Xan1330 và Xan332 đƣợc thiết
kế trên đoạn 16s-23s rDNA ITS.
Năm 2003, C. J. Vernière và ctv đã nghiên cứu sự phát triển và biểu hiện triệu
chứng bệnh của X. a. pv. citri trên cây có múi. C. J. Vernière và cộng sự đã kết luận
rằng để giảm bệnh loét nhà nông phải hạn chế tạo vết thƣơng cho cây, sự tăng trƣởng
quá nhiều chồi non và sự tăng trƣởng của quần thể X. a. pv. citri. Hệ thống chắn gió là
biện pháp hạn chế sự lan tràn bệnh hiệu quả nhất. Các tác nhân sinh học khác nhƣ ấu
trùng của côn trùng chít hút cũng là phƣơng tiện truyền bệnh nguy hiểm. Khả năng
nhiễm bệnh của ký chủ có liên quan đến giai đoạn phát triển của cây.
Năm 2003, Jung-Gun- Kim và ctv, đã mô tả đặc tính của vùng gây bệnh hrp của
X. a. pv. glycines Vùng này gồm vùng hrp gen, vùng hcr gen và vùng hca gen.Trong
đó vùng hrp và hcr mã hóa cho loại protein đóng vai trò quan trọng trong quá trình
xâm nhiễm của vi khuẩn X. a. pv. glycine. Đặc tính của vùng hrp gen này là chứa
nhiều gen độc, thành phần G+C thấp.
Năm 2006, Dong Suk Park và ctv, đã thực hiện thành công phƣơng pháp PCR
với mồi chuyên biệt trên hrpW gen để phát hiện nhanh và chính xác X. a. pv.citri, là
loài gây bệnh loét trên cây có múi tại châu Á.
2.5.2. Tại Việt Nam
Năm 2002, Nguyễn Thị Thu Cúc -Phạm Thị Hoàng Oanh, trƣờng Đại Học Cần
Thơ, có nghiên cứu về dịch hại trên cam, quít, chanh, bƣởi. Nghiên cứu này tập hợp
12




hầu hết các thông tin về dịch hại phổ biến tại Việt Nam. Trong nghiên cứu này, tổng
cộng có trên 30 loài côn trùng và 15 loại bệnh phổ biến trên nhóm cam, quít, chanh,
bƣởi đã đƣợc trình bày và mô tả qua các phần nhƣ đặc điểm hình thái, sinh học, sinh
thái, sự gây hại, triệu chứng và các biện pháp đối phó.
Năm 2005, Vi Thị Thanh Hƣờng, trƣờng Đại Học Nông Lâm Thành Phố Hồ
Chí Minh đã nghiên cứu các tác nhân và biện pháp phòng trừ biện pháp phòng trừ
bệnh loét trên bƣởi ở xã Tân Bình - huyện Vĩnh Cửu - tỉnh Đồng Nai. Tác giả đã phân
lập đƣợc một số dòng vi khuẩn gây bệnh nhƣng chƣa định danh đƣợc. Đồng thời, tác
giả cũng xác định một số loại thuốc hóa học phòng trừ bệnh loét.
2.6. Quy trình định danh Xanthomona sp. .
2.6.1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp nuôi cấy, thực
hiện phản ứng sinh hóa
1. Sử dụng môi trường chọn lọc để phân lập dòng gây bệnh (Bảng 2.1)
2. Xác định dựa vào sắc tố vàng Xanthomonadin.
(Phƣơng pháp thực hiện sẽ nêu ở phần 3.4.3 phƣơng pháp và vật liệu)
3. Thực hiện thí nghiệm sinh hóa và quan sát hình thái (Bảng 2.2)
a) Khả năng phát triển trong môi trƣờng YS ở 35
o
C trong 10-12 ngày.
b) Kiểm tra sự tạo nhầy, màu sắc của khuẩn lạc trên môi trƣờng GYCA hoặc
YDC trong 2-3 ngày.
c) Kiểm tra khả năng phân hủy protein: là thử nghiệm khả năng phân hủy
casein trong dịch sữa có chứa chất chỉ thị bromcresol purple đã khử trùng.
Dịch sữa và khuẩn đƣợc ủ 27
o
C quan sát phản ứng phân hủy.
d) Kiểm tra thủy phân asculin: phản ứng dƣơng tính khi dịch đổi màu nâu
tối (môi trƣờngYS lỏng + ferric ammonium citrate 0,05% và asculin 0,1%,
pH 6,8).
e) Kiểm tra khả năng thủy phân gelatin.
f) Kiểm tra khả năng tạo urease.
g) Kiểm tra tạo axit từ carbohydrates.

13




4. Kiểm tra tính gây bệnh
Khẳng định độc tính dòng phân lập đƣợc bằng cách chủng nhân tạo. Ký chủ
đƣợc chủng hoàn toàn là cây sạch bệnh. Tạo vết thƣơng trên cây ký chủ. Sau đó nhỏ
dòng vi khuẩn đã kiểm tra các bƣớc trên lên vết thƣơng. Đặt cây ký chủ đã chủng vào
điều kiện tối ƣu cho bệnh phát triển. Thông thƣờng thì ở nhiệt độ 27
o
C-30
o
C, trong
vòng 7 ngày sau khi chủng thì thấy triệu chứng bệnh.
2.6.2 Quy trình định danh theo phƣơng pháp phân tử
Dựa trên quy trình định danh bằng phƣơng pháp nuôi cấy và kiểm tra sinh hóa
nhƣng bổ sung thêm một số phƣơng pháp sinh học phân tử để định danh chính xác ở
mức loài. Quy trình gồm các bƣớc sau:
1. Phân lập và kiểm tra hình thái, sinh hoá trên các môi trƣờng khác nhau nhƣ
NA, YGA, YDC, KB.
2. Tiến hành kiểm tra dòng phân lập đƣợc bằng phản ứng ELISA để kiểm tra và
phân loại dựa trên độc tính gây bệnh.
3. Kiểm tra sự oxy hóa nguồn cacbon (khả năng tạo axit từ đƣờng cacbon).
4. Kiểm tra khả năng gây bệnh của dòng phân lập bằng phƣơng pháp chủng
nhân tạo.
5. Thực hiên phản ứng PCR với cặp primer đƣợc thiết kế trên vùng 16s-23s
rDNA ITS.
6. Tiến hành cắt bằng enzyme giới hạn nghiên cứu sự đa dạng di truyền.
7. Đọc trình tự sản phẩm PCR trên vùng 16s-23s sẽ định danh đƣợc dòng vi
khuẩn gây bệnh ở mức loài. (M. H. R Khoodoo và ctv, 2005).






Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×

×