Tải bản đầy đủ

Tuyển chọn, định danh vi khuẩn Bacillus an toàn trong thực phẩm sinh enzyme β-galactosidase chịu nhiệt, bước đầu tinh sạch và xác định một sốđặc tính của enzyme

BỘ NÔNG NGHIỆP VÀ PHÁT TRIỂN NÔNG THÔN
HỌC VIỆN NÔNG NGHIỆP VIỆT NAM
------------------------------------

BÁO CÁO TỔNG KẾT ĐỀ TÀI NGHIÊN CỨU
KHOA HỌC CẤP HỌC VIỆN
Tên đề tài: “Tuyển chọn, định danh vi khuẩn Bacillus an toàn trong thực phẩm
sinh enzyme β-galactosidase chịu nhiệt, bước đầu tinh sạch và xác định một số
đặc tính của enzyme”

Mã số

: T2017-08-57

Người chủ trì

: TS. Nguyễn Hoàng Anh

Thời gian thực hiện : Tháng 3/2017 –Tháng 3/2018

Hà Nội 2018



DANH SÁCH
Những người tham gia thực hiện đề tài và đơn vị phối hợp chính
I. Những người tham gia thực hiện đề tài
1. TS. Nguyễn Hoàng Anh
2. ThS. Phạm Thị Dịu
3. KS. Nguyễn Thị Hồng
4. SV Đặng Thị Nga (CNSH B, K58)
5. SV Nguyễn Thị Diên (CNTP B, K60)
6. SV Lê Thị Lan Anh (CNTP B, K60)
II. Đơn vị phối hợp chính

i


MỤC LỤC

DANH MỤC CÁC BẢNG...........................................................................................................................................iv
DANH MỤC CÁC HÌNH.............................................................................................................................................v
PHẦN THỨ NHẤT: ĐẶT VẤN ĐỀ............................................................................................................................3
1.2.1. Mục đích...............................................................................................................................................................5
1.2.2. Yêu cầu..................................................................................................................................................................5
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme...........................................................................................5
PHẦN THỨ HAI – TỔNG QUAN TÀI LIỆU..........................................................................................................6
3.1. Đối tượng nghiên cứu..........................................................................................................................................13
3.2. Nội dung nghiên cứu............................................................................................................................................13
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme.........................................................................................13
3.3. Phương pháp nghiên cứu....................................................................................................................................13
4.1. Kết quả sàng lọc các chủng Bacillus có hoạt độ β-galactosidase..................................................................23
5.1. Kết luận..................................................................................................................................................................30
5.2. Kiến nghị................................................................................................................................................................30
TÀI LIỆU THAM KHẢO..........................................................................................................................................31

ii


DANH MỤC CHỮ VIẾT TẮT VÀ KÍ HIỆU

Viết tắt

Tên đầy đủ

CATA
CA
EDPIM
IPM
JAR

Check all that apply
Correspondence Analysis
Euclidean Distance Ideal Point Mapping
Ideal profile method
Just about right

iii


DANH MỤC CÁC BẢNG

DANH MỤC CÁC BẢNG...........................................................................................................................................iv
DANH MỤC CÁC HÌNH.............................................................................................................................................v
PHẦN THỨ NHẤT: ĐẶT VẤN ĐỀ............................................................................................................................3
1.2.1. Mục đích...............................................................................................................................................................5
1.2.2. Yêu cầu..................................................................................................................................................................5
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme...........................................................................................5
PHẦN THỨ HAI – TỔNG QUAN TÀI LIỆU..........................................................................................................6
3.1. Đối tượng nghiên cứu..........................................................................................................................................13
3.2. Nội dung nghiên cứu............................................................................................................................................13
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme.........................................................................................13
3.3. Phương pháp nghiên cứu....................................................................................................................................13
4.1. Kết quả sàng lọc các chủng Bacillus có hoạt độ β-galactosidase..................................................................23
4.1. Kết quả sàng lọc các chủng Bacillus có hoạt độ β-galactosidase..................................................................23
5.1. Kết luận..................................................................................................................................................................30
5.2. Kiến nghị................................................................................................................................................................30
TÀI LIỆU THAM KHẢO..........................................................................................................................................31

iv


DANH MỤC CÁC HÌNH

DANH MỤC CÁC BẢNG...........................................................................................................................................iv
DANH MỤC CÁC HÌNH.............................................................................................................................................v
PHẦN THỨ NHẤT: ĐẶT VẤN ĐỀ............................................................................................................................3
1.2.1. Mục đích...............................................................................................................................................................5
1.2.2. Yêu cầu..................................................................................................................................................................5
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme...........................................................................................5
PHẦN THỨ HAI – TỔNG QUAN TÀI LIỆU..........................................................................................................6
3.1. Đối tượng nghiên cứu..........................................................................................................................................13
3.2. Nội dung nghiên cứu............................................................................................................................................13
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của nhiệt độ, ảnh hưởng của pH,
ảnh hưởng của ion kim loại đến hoạt tính của enzyme.........................................................................................13
3.3. Phương pháp nghiên cứu....................................................................................................................................13
4.1. Kết quả sàng lọc các chủng Bacillus có hoạt độ β-galactosidase..................................................................23
4.1. Kết quả sàng lọc các chủng Bacillus có hoạt độ β-galactosidase..................................................................23
5.1. Kết luận..................................................................................................................................................................30
5.2. Kiến nghị................................................................................................................................................................30
TÀI LIỆU THAM KHẢO..........................................................................................................................................31

v


vi


TÓM TẮT KẾT QUẢ NGHIÊN CỨU
ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP HỌC VIỆN
Tên đề tài: Tuyển chọn, định danh vi khuẩn Bacillus an toàn trong thực phẩm
sinh enzyme β-galactosidase chịu nhiệt, bước đầu tinh sạch và xác định một số đặc
tính của enzyme
Mã số: T2017-08-57
Chủ nhiệm đề tài: TS. Nguyễn Hoàng Anh

Tel.: 0978973346

E-mail: hoanganhcntp@vnua.edu.vn
Cơ quan chủ trì đề tài: Học Viện Nông nghiệp Việt Nam
Cơ quan và cá nhân phối hợp thực hiện:
Thời gian thực hiện: Tháng 3/2017 –Tháng 3/2018
1. Mục tiêu:
Mục tiêu chung
Tuyển chọn và định danh vi khuẩn Bacillus an toàn trong thực phẩm có khả năng
sinh enzyme β- galactosidase chịu nhiệt, bước đầu tinh sạch và xác định đặc tính của
enzyme
Mục tiêu cụ thể
- Tuyển chọn chủng vi khuẩn Bacillus đã được định danh sơ bộ từ ngân hàng
chủng cuả Khoa công nghệ thực phẩm có khả năng sinh enzyme β-galactosidase
- Tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt
- Định danh chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt bằng
phương pháp xác định trình tự gen 16S rRNA.
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của
nhiệt độ, ảnh hưởng của pH, ảnh hưởng của ion kim loại đến hoạt tính của enzyme
2. Nội dung chính:
Nội dung 1: Tuyển chọn chủng vi khuẩn Bacillus đã được định danh sơ bộ từ
ngân hàng chủng cuả Khoa công nghệ thực phẩm có khả năng sinh enzyme βgalactosidase
Nội dung 2: Tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt
Nội dung 3: Định danh chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt
bằng phương pháp xác định trình tự gen 16S rRNA
1


Nội dung 4: Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh
hưởng của nhiệt độ, ảnh hưởng của pH, ảnh hưởng của ion kim loại đến hoạt tính của
enzyme
3. Kết quả chính đạt được (khoa học, ứng dụng, đào tạo, kinh tế – xã hội,…)
3.1. Kết quả khoa học
- Tuyển chọn được 24 chủng vi khuẩn Bacillus sinh enzyme β-galactosidase.
- Tuyển chọn được 01 chủng Bacillus NT2.8 có khả năng bền ở nhiệt độ 60 oC
(sau 50 giờ ủ ở 60ºC hoạt độ của enzyme vẫn còn 50,6% so với hoạt độ ban đầu ). Kết
quả định danh bằng phương pháp sinh học phân tử chỉ ra rằng chùng Bacillus NT2.8 là
Bacillus flexus.
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme β-galactosidase tử
chủng Bacillus flexus NT2.8 .
- 01 bài báo được đăng trên tạp chí Khoa học nông nghiệp Việt Nam
3.2. Kết quả đào tạo
Hướng dẫn được 01 sinh viên đại học, 01 nhóm sinh viên nghiên cứu khoa học
PHẦN THỨ NHẤT – MỞ ĐẦU
THÔNG TIN KẾT QUẢ NGHIÊN CỨU
Tên đề tài: Tuyển chọn, định danh vi khuẩn Bacillus an toàn trong thực phẩm
sinh enzyme β-galactosidase chịu nhiệt, bước đầu tinh sạch và xác định một số đặc
tính của enzyme
Mã số: T2017-08-57
Chủ nhiệm: TS. Nguyễn Hoàng Anh
Thời gian thực hiện: Tháng 3/2017 –Tháng 3/2018
Kinh phí thực hiện: 50 triệu đồng (tự túc)
Cơ quan chủ trì: Học viện Nông nghiệp Việt nam

2


KẾT QUẢ ĐẠT ĐƯỢC
1. Các sản phẩm của đề tài
- Tuyển chọn được 24 chủng vi khuẩn Bacillus sinh enzyme β-galactosidase.
- Tuyển chọn được 01 chủng Bacillus NT2.8 có khả năng bền ở nhiệt độ 60 oC
(sau 50 giờ ủ ở 60ºC hoạt độ của enzyme vẫn còn 50,6% so với hoạt độ ban đầu ). Kết
quả định danh bằng phương pháp sinh học phân tử chỉ ra rằng chùng Bacillus NT2.8 là
Bacillus flexus.
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme β-galactosidase tử
chủng Bacillus flexus NT2.8.
- 01 bài báo được đăng trên tạp chí Khoa học nông nghiệp Việt Nam
Thông tin kết quả nghiên cứu được đăng tải trên website của Học viện Nông
nghiệp Việt Nam (Website: www.vnua.edu.vn)
2. Về bí quyết công nghệ và công nghệ sản phẩm
3. Ứng dụng trong sản xuất và hiệu quả kinh tế
Ứng dụng trong sản xuất các sản phẩm sữa và chế biến từ sữa không lactose ở
các doanh nghiệp
4. Đào tạo:
Hướng dẫn được 01 sinh viên đại học, 01 nhóm sinh viên nghiên cứu khoa học
5. Tình hình sử dụng kinh phí: đã hoàn tất thủ tục thanh/quyết toán với tổng
kinh phí tự túc là 50 triệu đồng năm 2017

Xác nhận của cơ quan chủ trì
(ký, đóng dấu)

Ngày

tháng

năm

Chủ nhiệm đề tài
(ký, họ và tên)

Nguyễn Hoàng Anh
PHẦN THỨ NHẤT: ĐẶT VẤN ĐỀ

3


1.1. Tính cấp thiết của đề tài
Enzyme β-galactosidase còn được gọi là lactase, là enzyme xúc tác cho quá trình
thủy phân lactose thành glucose và galactose (Davail và cs, 1994). Nhờ khả năng phân
giải lactose mà β- galactosidase được sử dụng nhiều cho ngành công nghiệp thực
phẩm, đặc biệt là trong ngành công nghiệp chế biến sữa và các sản phẩm từ sữa. βgalactosidase được sử dụng để thủy phân lactose nhằm làm tăng khả năng tiêu hóa sữa
cho người bị dị ứng với lactose, cải thiện các chức năng của các sản phẩm từ sữa, bổ
sung vào quá trình lên men bơ sữa để tránh sự kết tinh lactose và tăng độ ngọt của sản
phẩm. Ngoài ra trong y dược, chúng được sử dụng làm thuốc trợ tiêu hóa cho những
người thiếu khả năng hấp thụ lactose (Trương Nam Hải, 2004). Enzyme βgalactosidase có khả năng chịu nhiệt đóng vai trò quan trọng trong quá trình thủy phân
lactose ở các sản phẩm chế biến nhiệt độ cao và các sản phẩm sữa lên men. Sữa đã
được thủy phân lactose được sử dụng cho việc chế biến hương liệu, phô mai, và sữa
chua. Sự thủy phân lactose trong sữa sẽ ngăn ngừa sự kết tinh lactose khi chế biến các
sản phẩm sữa cô đặc, các sản phẩm sữa cần gia nhiệt. Hơn nữa việc sử dụng βgalactosidase có khả năng hoạt động ở nhiệt độ cao trong sản xuất sữa và các sản
phẩm từ sữa làm tăng hương vị cho sản phẩm (Parmjit và cs, 2010).
β-galactosidase có thể tìm thấy ở động vật, thực vật, nấm men, nấm mốc và vi
khuẩn. Trong đó, enzyme thu nhận từ vi khuẩn ưu việt hơn cả vì vi khuẩn có sinh khối
nhỏ, sinh sản nhanh, nhưng tỉ lệ enzyme trong tế bào lớn. Mặt khác, môi trường dinh
dưỡng để nuôi cấy vi khuẩn lại rẻ tiền, dễ kiếm nên quy trình sản xuất chế phẩm
enzyme khá dễ dàng, hiệu suất thu hồi cao và ít tốn kém (Ngô Xuân Mạnh và cs,
2006).
Trong các loài vi khuẩn được nghiên cứu và sản xuất β-galactosidase, vi khuẩn
Bacillus được các nhà khoa học nghiên cứu nhiều bởi đây là loài vi khuẩn sinh bào tử,
phân bố nhiều trong tự nhiên, tồn tại được trong các điều kiện khác nhau, nhiều loài
được coi là an toàn trong thực phẩm. Thêm vào đó Bacillus thường sinh enzyme ngoại
bào cho nên dễ dàng thu nhận enzyme ở quy mô công nghiệp, mặt khác các enzyme
ngoại bào của vi khuẩn này có đặc tính cao và khả năng sinh enzyme chịu nhiệt cao
hơn so với các enzyme ngoại bào của những vi sinh vật khác (Đặng Thị Thu và cs,
2007). Cho đến nay trên thế giới và Việt Nam đã có nhiều nghiên cứu về tuyển chọn vi

4


khuẩn Bacillus có khả năng sinh β-galactosidase.Tuy nhiên, việc nghiên cứu và đưa vào
ứng dụng sản xuất của β-galactosidase có đặc tính chịu nhiệt còn rất hạn chế.
Từ những cơ sở trên, nghiên cứu này được thực hiện với mục tiêu tuyển chọn
được chủng Bacillus sinh enzyme β - galactosidase chịu nhiệt, làm cơ sở cho ứng dụng
vào việc chế biến một số loại thực phẩm chứa lactose.
1.2. Mục đích – Yêu cầu
1.2.1. Mục đích
Tuyển chọn và định danh vi khuẩn Bacillus an toàn trong thực phẩm có khả năng
sinh enzyme β- galactosidase chịu nhiệt, bước đầu tinh sạch và xác định đặc tính của
enzyme
1.2.2. Yêu cầu
- Tuyển chọn chủng vi khuẩn Bacillus đã được định danh sơ bộ từ ngân hàng
chủng cuả Khoa công nghệ thực phẩm có khả năng sinh enzyme β-galactosidase
- Tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt
- Định danh chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt bằng
phương pháp xác định trình tự gen 16S rRNA.
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của
nhiệt độ, ảnh hưởng của pH, ảnh hưởng của ion kim loại đến hoạt tính của enzyme

5


PHẦN THỨ HAI – TỔNG QUAN TÀI LIỆU
2.1. Đại cương về enzyme β-galactosidase
2.1.1. Enzyme β-galactosidase
β-galactosidase là enzyme có khả năng xúc tác cho hai kiểu phản ứng: phản ứng
thủy phân và phản ứng chuyển gốc galactozyl. Phản ứng thủy phân chính của βgalactosidase thủy phân đường đôi lactose thành hai đường đơn glucose và galactose,
và trong một số trường hợp enzyme tham gia phản ứng transgalactosylation chuyển
gốc galactose đến cơ chất lactose tạo galacto - oligosaccharides (GOS) (Davail và cs,
1994). Galacto - oligosaccharides cùng với fructo - oligosaccharides được nghiên cứu
nhiều nhất tạo ra prebiotic oligosaccharides có lợi cho con người bằng cách kích thích
sự tăng trưởng và hoạt động của vi khuẩn có lợi trong hệ tiêu hóa của người.

Hình 2.1. Sơ đồ thủy phân lactose của enzyme β-galactosidase
2.1.2. Nguồn thu nhận
β-galactosidase trong tự nhiên có thể tìm thấy ở các loài thực vật, động vật và vi
sinh vật. Tuy nhiên, tính chất của enzyme được thu nhận từ các nguồn khác nhau có sự
khác nhau rõ rệt. Nguồn enzyme từ động vật và thực vật rất khó triển khai theo quy mô
công nghiệp vì những hạn chế sinh lí và hạn chế kỹ thuật. Enzyme được sản xuất từ vi
sinh vật ngày càng nhiều, là giới sinh vật được sử dụng làm nguồn sản xuất enzyme
theo quy mô công nghiệp. So với động vật và thực vật, vi sinh vật có rất nhiều ưu điểm
(Nguyễn Đức Lượng và cs, 2004). Những ưu điểm đó là:
(1) Tốc độ sinh sản của vi sinh vật rất mạnh.Trong một thời gian nuôi cấy ngắn,
ta có thể thu được một lượng sinh khối rất gấp hàng ngàn lần so với tốc độ tăng sinh
khối của động vật và thực vật. Để đạt được tốc độ tăng sinh khối lớn như vậy, vi sinh
vật phải chuyển hóa một khối lượng cơ chất rất lớn. Cũng từ nghiên cứu trên E. coli,
nhiều nhà khoa học cho thấy rằng trong vòng 24 giờ, vi khuẩn E. coli có thể chuyển
6


hóa được khối lượng cơ chất lớn hơn một ngàn lần khối lượng cơ thể chúng. Để
chuyển hóa được khối lượng cơ chất lớn như vậy, chúng phải tổng hợp ra được lượng
enzyme rất lớn. Bởi vì, mọi chuyển hóa cơ chất trong tế bào là do enzyme đảm nhận.
Chính vì thế, nếu sử dụng vi sinh vật như nguồn sinh học để sản xuất enzyme rất có
lợi. Trong một khoảng thời gian ngắn, không những ta thu được lượng sinh khối lớn
(để thu enzyme nội bào) mà còn thu được lượng enzyme ngoại bào vừa nhiều, vừa có
hoạt tính riêng rất cao.
(2) Enzyme thu nhận từ vi sinh vật có hoạt tính rất cao. Ưu điểm này gắn liền với
tốc độ chuyển hóa cơ chất và gắn liền với tốc độ sinh sản và phát triển của vi sinh vật.
(3) Vi sinh vật rất thích hợp cho sản xuất theo quy mô công nghiệp. Trong sản
xuất này, quá trình sinh trưởng, phát triển và sinh tổng hợp enzyme của vi sinh vật hoàn
toàn không phụ thuộc vào khí hậu bên ngoài như sản xuất enzyme từ nguồn thực vật và
động vật.
(4) Nguồn nguyên liệu dùng sản xuất enzyme theo quy mô công nghiệp rẻ tiền và
dễ kiếm. Đây cũng chính là lợi thế rất quan trọng. Nhờ đó, ta có thể làm giảm giá
thành sản phẩm và có thể sản xuất ở mọi nơi trên thế giới.
2.1.3. Enzyme β-galactosidase từ vi khuẩn
β-galactosidase ở vi khuẩn có thể ở dạng ngoại bào hoặc nội bào (Davail và cs,
1994). Enzyme ngoại bào dễ tách, không phải phá vỡ tế bào, không lẫn chung với các
thành phần nội bào, nếu có chỉ là một enzyme ngoại bào khác, có tính bền vững mạnh,
phương pháp tinh sạch dễ và rẻ tiền. Enzyme nội bào khó tách, phải phá vỡ tế bào,
thường lẫn chung với các chất khác của tế bào sau khi phá vỡ (acid nucleic, chất nguyên
sinh, lipid,…), chỉ bền vững ở trong môi trường nội bào, phương pháp tinh sạch khó
thực hiện, quy trình công nghệ phức tạp, giá thành đắt. β-galactosidase ngoại bào được
tổng hợp sau đó tiết ra ngoài tế bào và tham gia vào quá trình thủy phân các hợp chất
hữu cơ bên ngoài môi trường xung quanh (Nguyễn Đức Lượng và cs, 2004). Đây là một
enzyme thích ứng điển hình, được tổng hợp khi trong môi trường chỉ có lactose hay các
chất có cấu trúc tương tự lactose như axit lactobiotic. β-galactosidase của vi khuẩn có
khối lượng phân tử khá lớn (trên 100 kDa), thường hoạt động tối ưu ở 37ºC trong điều
kiện môi trường pH trung tính 6.0 - 8.0 (Trương Nam Hải và cs, 2004).
Vi khuẩn E. coli là đối tượng được nghiên cứu đầu tiên. Cấu trúc bậc ba của
enzyme từ E. coli cũng như cơ chế điều hòa phiên mã của gene lacZ đã được khẳng
7


định tạo điều kiện cho việc nghiên cứu kỹ hơn về cơ chế xúc tác của enzyme này. Mặc
dù vậy, việc sử dụng enzyme này vào các quá trình sinh học chỉ được kiểm nghiệm ở
quy mô phòng thí nghiệm do vi khuẩn này không được phép có mặt trong thực phẩm.
Lĩnh vực chủ yếu của enzyme từ vi khuẩn E. coli này là trong nghiên cứu sinh học
phân tử, trong kỹ nghệ và trong hóa miễn dịch.
Enzyme β-galactosidase từ Streptcoccus thermophiles – một trong những vi
khuẩn được sử dụng ở công nghệ chế biến các sản phẩm lên men từ sữa cũng đã được
sử dụng để thủy phân lactose trong sữa ở quy mô công nghiệp do tính bền nhiệt mà độ
an toàn khi được sử dụng dưới dạng phụ gia thực phẩm. Nó cũng được dùng làm chất
xúc tác cho quá trình sản xuất các galacto-oligosaccharides từ lactose do hoạt tính
chuyển hóa galactozyl của nó cao. Đối với vi khuẩn chúng có thể phát triển tối ưu
trong dải pH từ 6.5 đến 7.5. Chúng kém phát triển ở pH dưới 4 hoặc trên 8 (Coenen và
cs, 2000).
Một số β-galactosidase từ vi khuẩn để có hoạt tính cần phải có mặt các ion hóa trị
1 hoặc các ion hóa trị 2. Ví dụ như β-galactosidase từ S. restivirgula cần phải có mặt
nhiều ion kim loại hóa trị 2 để đạt đến độ bền nhiệt và hoạt tính tối đa. Tuy nhiên, một
số β-galactosidase khác lại không cần sự có mặt của các ion kim loại như enzyme từ
Rhizobium melioti (Toru Nakayama và cs, 1996).
2.2. Ứng dụng của β-galactosidase
Enzyme β-galactosidase có vai trò vô cùng to lớn trong ngành công nghiệp thực
phẩm nói chung và ngành công nghiệp chế biến sữa nói riêng, ứng dụng chính là thủy
phân lactose trong sữa thành glucose và galactose (Davail và cs, 1994). Thủy phân
lactose trong whey là một trong ứng dụng quan trọng của β-galactosidase trong ngành
công nghiệp chế biến sữa, giúp làm tăng độ ngọt của sản phẩm (Rosenberg M, 2006).
Enzyme này được sử dụng trong ngành công nghiệp sữa để sản xuất sữa và các sản
phẩm sữa không có lactose, khắc phục tình trạng không dung nạp lactose ở con người
(Haju và cs, 2012).
Ngoài ra, sữa không lactose được sử dụng cho việc chế biến hương liệu sữa, phô
mai, và sữa chua. Sự thủy phân lactose trong sữa và dùng sữa chế biến thực phẩm
cũng ngăn ngừa sự kết tinh lactose khi đông lạnh sữa và sản phẩm sữa cô đặc. Hơn
nữa, việc sử dụng sữa đã thủy phân trong sản xuất sữa chua và pho mát sẽ làm tăng
quá trình axit hóa, bởi vì thủy phân lactose thường là bước làm chậm tốc độ của quá
8


trình, làm giảm thời gian đông đặc của sữa chua và tăng tốc độ phát triển cấu trúc và
hương vị cho pho mát (Parmjit S Panesar và cs, 2010). Chất lượng của sữa đông lạnh
và kem làm từ sữa cũng được cải thiện đáng kể khi thêm enzyme β-galactosidase. Nó
chống lại sự kết tinh đường lactose bằng cách thủy phân thành glucose và galactose và
làm giảm cấu trúc cát sạn.
Từ những ứng dụng thực tiễn trên mà β-galactosidase đã được các nhà khoa học
quan tâm để sản xuất enzyme từ nhiều nguồn vi sinh vật khác nhau, để có tiến hành
nghiên cứu sản xuất ở quy mô công nghiệp.
2.3. Tình hình nghiên cứu sản xuất β-galactosidase trong và ngoài nước
2.3.1. Tổng quan tình hình nghiên cứu trong nước thuộc lĩnh vực của đề tài
Nhóm của Nguyễn Thu Hà và cs, 2006 đã nghiên cứu sự biểu hiện của enzyme
lactase ở 2 chủng Lactobacilus reuteri L103 và L461 với mục đích xác định mức độ
biểu hiện của gene mã hóa cho enzyme này và bước đầu xác định một số đặc tính của
enzyme. Kết quả chỉ ra rằng enzyme có cấu tạo gồm 2 tiểu phần (2 chuỗi peptide có
trọng lượng là 35kDa và 85kDa), có khả năng chuyển hóa và tạo ra các prebioticoligosaccharide. Các enzyme này có khoảng pH hoạt động hẹp, một enzyme từ pH 3.8
– 4.0 (chủng L461) và một pH 4.6 – 4.8 (chủng L103). Tuy nhiên, kết quả bền nhiệt
không được chỉ ra ở nghiên cứu này.
Nguyễn Văn Cách và cs, 2008 đã tạo dòng β-galactosidase từ Aspergillus oryzae
và xác định một số tính chất lý-hóa của nó. Trần Văn Giang và cs, 2008 đã tạo dòng và
phân tích trình tự gen mã hóa β-galactosidase từ chủng Bacillus subtilis G1. Tuy nhiên,
các thông tin về độ bền nhiệt của enzyme chưa được đưa ra một cách cụ thể. Ngoài ra
còn có công trình nghiên cứu của Trương Nam Hải và cs với đề tài cấp quốc gia
“Nghiên cứu, phân lập và tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp
enzyme beta-galactosidase có hiệu suất cao và ứng dụng trong thực phẩm” đã thành
công trong biểu hiện của và xác đinh hoạt tính β-galactosidase, nhưng việc biểu hiện
trong E.coli lại không an toàn trong thực phẩm, protein thu được đa phần là enzyme
nội bào dẫn đến gặp khó khăn trong việc thu hồi enzyme có hoạt tính cao ứng dụng
trong quy mô công nghiệp. Vì vậy, ở Việt Nam những nghiên cứu về β-galactosidase
mới dừng lại ở nghiên cứu cơ bản và chưa đưa vào sản xuất enzyme này. Vì vậy, việc
nghiên cứu tuyển chọn và định danh được các chủng Bacillus với các ưu điểm nổi bật
so với Escherichia coli như an toàn thực phẩm, dễ sinh enzyme bền ở nhiệt độ cao
9


(Driks, 1999). Enzyme thu nhận được xác định hoạt tính, kiểm tra khả năng chịu nhiệt
để có thể sử dụng trong các quá trình chế biến cần phải gia nhiệt ở nhiệt độ cao trong
các sản phẩm chế biến từ sữa là hết sức cần thiết.
2.1.4. Tổng quan tình hình nghiên cứu nước ngoài thuộc lĩnh vực của đề tài
Trên thế giới việc tạo dòng và nghiên cứu sản xuất enzyme β-galactosidase đã
được biết đến từ lâu. Một vài công trình tiêu biểu của Petzelbauer và cs, 2000, Hanson
và Adlercreutz, 2001, Splechtna và cs, 2001, Petzelbauer và cs, 2002, Park và cs, 2008,
,… cho thấy nguồn gen mã hóa β-galactosidase đã được phân lập từ các nguồn vi
khuẩn khác nhau và được tạo dòng và biểu hiện trong E.coli. Các nghiên cứu này là
các nghiên cứu cơ bản, với mục đích để nghiên cứu sự biểu hiện của gene mã hóa cho
β-galactosidase trong E.coli và thuận tiện cho việc tinh sạch và xác định hoạt tính của
enzyme.
Một số công trình công bố về tạo dòng và biểu hiện β-galactosidase từ vi khuẩn
lactic (Lactobacillus plantarum, Lactobacillus reuteri) trong vật chủ là vi khuẩn
Lactobacillus plantarum (Nguyễn TT và cs, 2012). Kết quả chỉ ra rằng enzyme biểu
hiện cao, chịu nhiệt ở 50oC khi có sự bổ sung Ca2+ trong phản ứng. Tuy nhiên, mục
đích của nghiên cứu này là sản xuất enzyme xúc tác tạo galactooligosaccharide, vector
biểu hiện vẫn còn gene kháng kháng sinh nên chưa đảm bảo an toàn trong thực phẩm.
2.4. Giới thiệu về vi khuẩn Bacillus
2.4.1. Các đặc điểm chung của vi khuẩn Bacillus
Vi khuẩn Bacillus là những vi khuẩn Gram dương. Thuộc chi Bacillaceae, có nội
bào tử hình ovan có khuynh hướng phình ra ở một đầu. Bacillus được phân biệt với
các loài vi khuẩn sinh nội bào tử khác bằng hình dạng tế bào hình que, sinh trưởng
dưới điều kiện hiếu khí hoặc kị khí không bắt buộc. Tế bào Bacillus có thể đơn hoặc
chuỗi và chuyển động bằng tiên mao.

Hình 2.4. Hình thái khuẩn lạc của vi khuẩn Bacillus
10


Hình 2.5. Hình thái vi khuẩn Bacillus qua kính hiển vi quang học
Nhờ khả năng sinh bào tử nên vi khuẩn Bacillus có thể tồn tại trong thời gian rất
dài dưới các điều kiện khác nhau và rất phổ biến trong tự nhiên nên có thể phân lập từ
rất nhiều nguồn khác nhau như đất, nước, trầm tích biển, thức ăn, sữa,… (Priest FG và
Grigorova R, 1991).
Tất cả các loài thuộc chi Bacillus đều có khả năng dị dưỡng và hoại sinh nhờ sử
dụng các chất hữu cơ đa dạng như đường, amino acid, acid hữu cơ,… Một vài loài có
thể lên men carbohydrate tạo thành glycerol và butanediol, một vài loài như Bacillus
megaterium thì không cần chất hữu cơ để sinh trưởng, một vài loài khác thì cần
amino axit, vitamin nhóm B. Hầu hết đều là loài ưa nhiệt trung bình với nhiệt độ tối
ưu là 30-450C, nhưng cũng có một số loài ưa nhiệt với nhiệt độ tối ưu là 65 0C
(Rosovitz M J và cs, 1998).
Đa số Bacillus sinh trưởng với pH = 7, một số phù hợp với pH = 9-10 như
Bacillus alcalophillus, hay có loại phù hợp với với pH = 2-6 như Bacillus
acidocaldrius (Nguyễn Thị Trần Thụy, 2009).
2.4.2. Ứng dụng của vi khuẩn Bacillus sinh enzyme β-galactosidase
Các chủng vi khuẩn Bacillus có khả năng sinh tổng hợp mạnh mẽ nhiều enzyme
khác nhau. Enzyme sản sinh bởi vi khuẩn Bacillus hầu hết là emzyme ngoại bào nên
dễ dàng cho việc thu nhận ở quy mô công nghiệp. Ngoài ra, trong tự nhiên nhiều
chủng vi khuẩn Bacillus có khả năng chịu nhiệt của một số chủng vi khuẩn, nên
enzyme ngoại bào của loài vi khuẩn này cũng có tiềm năng cao về tính bền nhiệt ở
nhiệt độ cao.
Nghiên cứu của Chen và cs (2008) đã chỉ ra được nhiệt độ và pH tối ưu cho hoạt
động của β-galactosidase của vi khuẩn Bacillus Stearothermophilus là ở 70ºC và pH
7.0. Xác định được độ bền nhiệt của enzyme này ở 65ºC trong 50 giờ và 70ºC, trong 9
11


giờ thì hoạt độ β-galactosidase vẫn giữ được 50% so với ban đầu. Enzyme chịu nhiệt
tái tổ hợp của vi khuẩn này ứng dụng cho cả hai quá trình thủy phân lactose và sản
xuất galactose-oligosaccharides trong chế biến sữa.
Các nghiên cứu chỉ ra được tính bền nhiệt của các chủng vi khuẩn Bacillus chủ
yếu hoạt động ở pH trung tính, những nghiên cứu về khả năng hoạt động ở pH axit của
vi khuẩn Bacillus vẫn còn hạn chế. Vì vậy mà việc nghiên cứu khả năng sinh βgalactosidase có khả năng chịu nhiệt và chịu pH axit từ vi khuẩn Bacillus để ứng dụng
trong các ngành công nghiệp thực phẩm trở nên vô cùng cấp thiết.

12


PHẦN THỨ BA - ĐỐI TƯỢNG – NỘI DUNG VÀ PHƯƠNG PHÁP
NGHIÊN CỨU
3.1. Đối tượng nghiên cứu
160 chủng vi khuẩn Bacillus spp. phân lập từ dạ cỏ bò, tương ớt, thịt lên men,
nước thải nhà máy sữa, sữa chua lên men, lòng non lợn ở các vùng khác nhau đã được
định danh sơ bộ bằng phương pháp hình thái, sinh hoá được sử dụng để tuyển chọn
chủng sinh enzyme β - galactosidase chịu nhiệt.
3.2. Nội dung nghiên cứu
- Tuyển chọn chủng vi khuẩn Bacillus đã được định danh sơ bộ từ ngân hàng
chủng cuả Khoa công nghệ thực phẩm có khả năng sinh enzyme β-galactosidase
- Tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt
- Định danh chủng vi khuẩn Bacillus sinh β-galactosidase chịu nhiệt bằng
phương pháp xác định trình tự gen 16S rRNA.
- Bước đầu tinh sạch và xác định một số đặc tính của enzyme: ảnh hưởng của
nhiệt độ, ảnh hưởng của pH, ảnh hưởng của ion kim loại đến hoạt tính của enzyme
3.3. Phương pháp nghiên cứu
3.3.1. Phương pháp hoạt hóa giống và nuôi cấy giống để thu dịch enzyme
ngoại bào
Phương pháp hoạt hóa và nuôi cấy giống được tiến hành theo Nguyễn Lân Dũng
và (1978) và được mô tả như sau:
-Phương pháp hoạt hóa giống
Chuẩn bị các ống nghiệm chứa 5ml môi trường NB, đem hấp khử trùng ở 121oC,
1atm, trong 20 phút. Dùng đầu que cấy nhọn tiệt trùng lấy khuẩn lạc và cho vào ống
nghiệm. Nút miệng ống nghiệm bằng nút bông, đánh dấu tên chủng, thời gian cấy. Các
thao tác thí nghiệm đều được thực hiện trong buồng cấy vi sinh và dưới ngọn lửa đèn
cồn. Sau đó, các ống nghiệm được chuyển vào tủ nuôi cấy, nuôi ở 37 oC, lắc 200
vòng/phút trong vòng 24 giờ.
-Phương pháp nuôi cấy giống để thu dịch enzyme ngoại bào
Tiếp giống 1% từ ống nghiệm hoạt hóa vào bình tam giác chứa môi trường NB
có bổ sung 1% đường lactose đã hấp khử trùng ở 121oC trong 15 phút và nuôi cấy ở 37
o

C, lắc 200 vòng/phút trong 24h. Tiến hành li tâm 6000 vòng/ phút ở 4 oC trong 20
13


phút, gạn lấy phần dịch nổi bảo quản ở 4 oC để xác định khả năng sinh enzyme β –
galactosidase.
3.3.2. Xác định khả năng sinh β- galactosidase bằng phương pháp đĩa thạch
Khả năng sinh β-galactosidase của các chủng Bacillus được xác định theo
phương pháp của Toru Nakayama và Teruo Amachi, 1996, được mô tả như sau:
Nguyên tắc: β-galactosidase thuỷ phân X-gal hình thành sản phẩm kết tủa màu
xanh da trời kiểu indigo. Vì vậy, vi khuẩn dương tính với enzyme này sẽ tạo khuẩn lạc
màu xanh khi nuôi cấy trên môi trường đĩa thạch bổ sung chỉ thị X-gal và chất cảm
ứng IPTG hoặc lactose.
- Cách 1: Xác định khả năng sinh β-galactosidase bằng phương pháp cấy trang
trên đĩa thạch
+ Môi trường NA được hấp vô trùng và làm nguội, sau đó dùng micropipet hút,
bổ sung 60 µl X-gạl nồng độ 20 mg/ml và 10 µl IPTG 0,1 M trên mỗi đĩa, trang đều.
+ Hút 3 µl dịch khuẩn đã được hoạt hóa ở phần 3.3.1 lên các đĩa thạch chỉ thị
này, trang đều.
+ Đĩa cấy vi sinh vật được đưa vào tủ nuôi cấy ở nhiệt độ 37 ⁰C, trong điều kiện
tối. Kiểm tra kết quả sau 24h, 48h và 72h.
- Cách 2: Xác định khả năng sinh β-galactosidase bằng phương pháp nhỏ dịch
nuôi cấy trên đĩa thạch
+ Môi trường NA được hấp vô trùng và làm nguội, sau đó dùng micropipet hút
và bổ sung 60 µl X-gal nồng độ 20 mg/ml và 10 µl IPTG 0,1 M trên mỗi đĩa, trang đều
+ Hút 3 µl dịch khuẩn, đã được hoạt hóa ở phần 3.3.1 nhỏ trên bề mặt đĩa thạch
chỉ thị, để khô dịch khuẩn trong 5 phút.
+ Đĩa làm xong được đưa vào tủ nuôi ở nhiệt độ 37 ⁰C, trong điều kiện tối.
Kiểm tra kết quả sau 24h, 48h và 72h.
- Cách 3: Xác định khả năng sinh β-galactosidase bằng phương pháp cấy ria trên
đĩa thạch
+ Môi trường NA được hấp vô trùng và làm nguội, sau đó dùng micropipet hút
và bổ sung 60 µl X-gal nồng độ 20 mg/ml và 10 µl IPTG 0,1 M trên mỗi đĩa, trang đều
+ Tiến hành lấy khuẩn lạc cấy ria chủng vi khuẩn trên mỗi đĩa
+ Đĩa cấy vi sinh vật được đưa vào tủ nuôi cấy ở nhiệt độ 37 ⁰C, trong điều kiện
tối. Kiểm tra kết quả sau 24h, 48h và 72h.
14


3.3.3. Xác định hoạt độ của β-galactosidase ngoại bào
Hoạt độ của β-galactosidase được xác định theo phương pháp của Nguyen và cs,
2006, được mô tả như sau:
Nguyên tắc: Hoạt độ β-galactosidase được xác định bằng cách cho enzyme này
phản ứng với cơ chất tổng hợp o-nitrophenyl-β-D-galactopyranoside (oNPG). Dưới tác
dụng của β-galactosidase, oNPG sẽ thủy phân thành galactose và o-nitrophenol. onitrophenol khi giải phóng sẽ chuyển hỗn hợp phản ứng sang màu vàng và hấp thụ
(Abs) ở bước sóng cực đại 420 nm.
- Bước 1: Xây dựng đường chuẩn oNP
Các dung dịch
1
Vdung dịch gốc (ml)
0
Vdung dịch đệm (ml)
5
Nồng độ (mM)
0
Dùng 0.5ml oNP và 0.75ml

2
3
4
5
0.1
0.2
0.3
0.4
4
3
2
1
0.4
0.8
1.2
1.6
Na 2CO3 đo ở bước sóng 420nm, dựa vào

6
0.5
0
2.0
sự tương

quan giữa nồng độ oNP và giá trị OD ở bước sóng 420nm xác định được tốc độ
phản ứng của oNP qua đường chuẩn dựng bằng phần mềm Excel.
Bảng 3.1. Số liệu dựng đường chuẩn oNP
STT
Nồng độ

1
0

2
0.04

3
0.08

4
0.12

5
0.16

6
0.2

oNP (mM)
Abs

0.0045

0.1326

0.2624

0.3878

0.5078

0.6336

Hình 3.1 Đường chuẩn oNP
- Bước 2: Xác định hoạt tính của enzyme

15


+ Hút 480 µl oNPG vào ống eppendorf 1,5ml, sau đó ống eppendorf được cho
vào máy ổn nhiệt (thermomixer) ở 30oC, chờ 5 phút để nhiệt độ trong ống eppendorf
đạt 30ºC trước khi đưa enzyme vào.
- Bắt đầu phản ứng bằng cách thêm 20 µl dung dịch enzyme ngoại bào (ở phần
3.3.1).
+ Lắc đều ở 600 vòng/phút trong 10 phút.
+ Dừng phản ứng enzyme bằng cách bổ sung 750 µl Na 2CO3 0.4 M vào trong
ống eppendorf.
+ Đo độ hấp quang trên máy so màu ở bước sóng 420 nm.
Mẫu đối chứng được tiến hành tương tự như mẫu thí nghiệm, trong đó 20 µl
dung dịch enzyme được thay thế bằng 20 µl dung dịch đệm phosphate pH 6.5.
Thí nghiệm lặp lại 2 lần, sai số ở 2 thí nghiệm không được vượt quá 5%.
Tính kết quả:
Hoạt tính enzyme có trong 1 ml dịch nuôi cấy theo công thức sau:

Trong đó:
U/ml:
Abs420nm:

Hoạt tính β- galactosidase
Độ hấp thụ quang của phản ứng màu đo được tại

420 nm
Blank:
Độ hấp thụ quang của mẫu đối chứng
SlopeoNPstandardcurve:
Hệ số góc của đường chuẩn oNP
treaction:
Thời gian phản ứng enzyme cơ chất (phút)
3.3.4. Phương pháp tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase
thủy phân có đặc tính chịu nhiệt
Phương pháp tuyển chọn chủng vi khuẩn sinh β-galactosidase chịu nhiệt được
xác định theo phương pháp của Nguyen và cs, 2012.
Để xác định khả năng chịu nhiệt của β-galactosidase, các enzyme này được ủ ở
nhiệt độ 60ºC. Tại các thời gian ủ khác nhau, enzyme lấy ra để xác định hoạt độ (theo
phương pháp mô tả ở mục 3.3.3). Độ bền nhiệt của enzyme được xác định bằng cách
so sánh % hoạt độ còn lại của enzyme tại thời điểm đo với thời điểm bắt đầu ủ.

16


3.3.5. Định danh chủng được tuyển chọn bằng phương pháp xác định trình tự
gen 16S rRNA
Chủng vi khuẩn sinh β-galactosidase chịu nhiệt được xác định trình tự gen và so
sánh mức độ tương đồng di truyền với các loài trên ngân hàng gen NBCI bằng công cụ
BLAST theo phương pháp của Maxam và Gibert, 1997.
3.3.5.1. Quy trình chiết DNA
- Lấy 50 – 100 µl dịch khuẩn vào tube 1.5 ml
- Dịch nuôi được ly tâm ở 5000 vòng trong 10 phút để thu sinh khối. Dùng pipet
hút cẩn thận dịch trong ra khỏi tube, giữ cặn.
- Hòa tan sinh khối trong 0.5 ml đệm (Tris-HCl, EDTA, NaCl, SDS).
- Ủ phản ứng ở nhiệt độ phòng trong 10 phút, siêu âm phá vỡ tế bào, 70% năng
lượng , 5 phút bật/ 5 phút tắt.
- Bổ sung lysozyme 20 μg/ml, ủ ở nhiệt độ 370C trong 1h.
- Bổ sung 0.15 ml CH3COOK.
- Ly tâm 10000 vòng, dùng pipet hút cẩn thận phần dịch trong bên trên (khoảng
600 µl, không lấy phần phân lớp).
- Bổ sung isopropanol tỉ lệ 1:1 so với thể tích dịch trong tube để kết tủa DNA.
- Lắc đều tube và để trong tủ -20ºC trong 30 phút.
- Ly tâm ở 13000 vòng trong 10 phút ở 40C để thu tủa DNA.
- Để lắng DNA, đổ dịch trong, thu DNA.
- Rửa tủa bằng cồn 70% 2 lần (mỗi lần dùng khoảng 500µl), sau đó cho vào máy spin.
- Làm khô cặn bằng cách mở nắp tube, để trong buồng cấy vô trùng 30 phút ở
nhiệt độ phòng.
- Hòa tan DNA trong 50µl nước cất 2 lần vô trùng.
- Kiểm tra chất lượng mẫu chiết DNA bằng điện di gel agarose (dùng 1-2µl dịch DNA).
3.3.5.2. Nhân DNA bằng PCR và giải trình tự gen
- Sử dụng cặp mồi đặc hiệu đã được sử dụng quốc tế: 27F/1492R, ới trình tự:
27F:

5’AGAGTTTGATCCTGGCTCAG 3’

1492R: 5’TACGGYTACCTTGTTACGACTT 3’
- Các phản ứng PCR được thực hiện trong tube 0,5ml với tổng thể tích phản ứng
là 25µl, thành phần của mỗi phản ứng PCR gồm:
5 mM dNTPs

: 1.5 µl
17


10X Taq Buffer

: 2.5 µl

5 µM 27F

: 1 µl

5 µM 1492R

: 1 µl

DNA template

: 1 µl

Taq DNA pol

: 0.3 µl

H2 O

: 17.5 µl

Tổng thể tích phản ứng

: 25 µl

- Chu trình nhiệt
95ºC
95ºC

5 phút
45 giây

x1 vòng

56ºC

1 phút

x30 vòng

72ºC
72ºC

1 phút 30 giây
5 phút

x1vòng

3.3.5.3. Chạy điện di
* Chuẩn bị:
- Dung dịch đệm TAE 0,5x.
- Bản gel: Cân 1g agarose cho vào 100ml TAE0,5x sau đó lắc nhẹ lọ để hòa tan
agarose. Sau đó đun trong lò vi sóng 3 – 4 phút, bổ sung Ethidium Bromide theo tỷ lệ
cứ 100ml dung dịch gel cho 4µl, lắc đều, để lọ ở nhiệt độ phòng. Khi dung dịch
agarose 1% nằm trong khoảng 400C thì đổ vào khuôn có đặt lược khi tạo lỗ khuôn. Để
khuôn ở nhiệt độ phòng.
- Các tube chứa 0,5ml chứa các sản phẩm PCR (đã đánh số thứ tự) cho vào mỗi
tube 4µl loading Dye X6, đảo đều và spin trong 5 giây.
*Tiến hành
- Sau 30 giây để khuôn ở nhiệt độ phòng thì tiến hành rút lược.
- Đặt cả khay khuôn gel vào bể điện di, đổ dung dịch đệm TAE 0,5x phủ ngập gel.
- Nhỏ mẫu vào giếng: dùng pipet hút 7 - 10µl dung dịch mẫu cần chuẩn đoán cho
vào mỗi giếng theo thứ tự. Ngoài các mẫu chạy PCR còn nhỏ thêm 1 giếng marker làm
chuẩn.
- Cắm nguồn điện cho máy điện di. Đặt ở hiệu điện thế 100V trong 25 phút, tắt
máy điện di, đặt bản gel được kiểm tra dưới ánh sáng tử ngoại. Quan sát các vệt DNA
hiện lên và chụp ảnh.
3.3.5.3. Giải trình tự chuỗi 16S RNA ribosome
18


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×

×