Tải bản đầy đủ

Bao cao tuan 4

CÔNG TY CP CÔNG NGHỆ SINH HỌC BIONET VIỆT NAM
Số 12N1 - Ngõ 53 – Đường Hoàng Cầu – Phường Ô Chợ Dừa – Quận Đống Đa – Hà Nội
Tel: 04-66-747-102; Hotline: 0988 683 082; Email:support@bionet.vn

BÁO CÁO CÔNG VIỆC THEO TUẦN
Người thực hiện:

Vũ Anh Tuấn

Tuần 4

22 – 29/9/2014

I. Các công việc đã làm trong tuần
STT

Công việc

Ghi chú

1


Đọc các tài liệu về Đột biến G6PD

2

Thiết kế Primer cho 8 đột biến thường gặp ở Việt Nam

3

Kết quả cụ thể liệt kê dưới đây

1. Viangchan 871G/A
Phenotype: G6PD VIANGCHAN (Khác: G6PD JAMMU)
cDNA Nucleotide : 871 GA
Exon: 9
Codon: Val291Met
Variation ID: rs137852327
RefSeqGene Mapping: NG009015.2

Gene (ID): G6PD (2539) Position: 19451

F_inner(G): 5’-GTCCGTGATGAGAAGGTCACGG-3’
R_inner(A): 5’-TGCACCTCTGAGATGCATTTCAAAAT-3’
F_common: 5’-CCAGATCTACCGCATCGACCACTA-3’
R_common: 5’-ATCATGGAACTGCAGCCTCACCT-3’

22bp
22bp
24bp
24bp

GC%
GC%
GC%
GC%

59.1
38.5
54.2
52.5

Tm:63.5
Tm:62.6
Tm:64.2
Tm:64.7

M – Product: 317 bp
N –Product: 277 bp
Common: 544 bp

2. Kaiping 1388G/A
Phenotype: G6PD KAIPING (Khác: G6PD ANANT, G6PD DHON, G6PD PETRICK-LIKE, G6PD
SAPPORO-LIKE)
cDNA Nucleotide : 1388 GA
Codon: Arg463His
Exon: 12
Variation ID: rs72554664
RefSeqGene Mapping: NG009015.2

Gene (ID): 2539

F_inner(A): 5’-GAGCTCCGTGAGGCCTGTCA-3’
R_inner(G): 5’-TGCAGCAGTGGGGTGAAAAGAC-3’
F_common: 5’-GAGTCGGAGCTGGACCTGACCTAC-3’
R_common: 5’-TCTCTTCATCAGCTCGTCTGCCTC-3’
M – Product: 127 bp
N –Product: 161 bp
Common: 246 bp

20bp
22bp
24bp
24bp

Position: 20316
GC%
GC%
GC%
GC%

65.0
54.5
54.2
62.5

Tm:64.6
Tm:64.1
Tm:66.4
Tm:64.6


3.Canton1376 G/T
cDNA Nucleotide: 1376 GT
Codon: Arg459Leu
Exon: 12
Variation ID: rs72554665

Position: 20304

F_inner(G): 5’-CGCAGCGACGAGCTTCG-3’


R_inner(T): 5’-GGTGAAAATACGCCAGGCCTTAA-3’
F_common: 5’-GGAGCTGGACCTGACCTACGG-3’
R_common: 5’-TTCATCAGCTCGTCTGCCTCC-3’

17
23
21
21

70.6
47.8
66.7
57.1

62.2
62.0
64.5
62.8

M-Product: 145 bp
N-Product: 132 bp
Common: 237 bp

4.Union1360 C/T
cDNA Nucleotide: 1360 CT
gDNA : 13763
Codon: Arg454Cys
Exon: 11
Class : II
Variation ID: rs137852324

Position: 20184

(Sử dụng primer của Nga đã báo cáo)
Normal primer

F-5’-TTCTGCGGGAGCCAGATGCACTTCGTGC-3’
ACG

Mutant primer

F-5’-TTCTGCGGGAGCCAGATGCACTTCGTTT-3’

Reverse primer (common)

R-5’-AGTGACGGGTGGAGGAGAGGCATGAGGTA-3’

Reverse complement

5’-TACCTCATGCCTCTCCTCCACCCGTCACT-3’

Mismatch: TG (weak), CT (strong)
Kiểm tra trên NCBI/Primer-BLAST :glucose-6-phosphate 1-dehydrogenase
Sequence (5'->3')

Length

Start

Stop

Tm

GC%

Forward primer

TTCTGCGGGAGCCAGATGCACTTCGTGC

28

15170

15197

72.53

60.71

Reverse primer

AGTGACGGGTGGAGGAGAGGCATGAGGTA

29

15490

15462

71.22

58.62

Product length

321

PCR Product:
TTCTGCGGGAGCCAGATGCACTTCGTGCGCAGGTGAGGCCCAGCTGCCGGCCCCTGCATACCTGTG
GGCTATGGGGTGGCCTTTGCCCTCCCTCCCTGTGTGCCACCGGCCTCCCAAGCCATACCATGTCCCCT
CAGCGACGAGCTCCGTGAGGCCTGGCGTATTTTCACCCCACTGCTGCACCAGATTGAGCTGGAGAA
GCCCAAGCCCATCCCCTATATTTATGGCAGGTGAGGAAAGGGTGGGGGCTGGGGACAGAGCCCAGC
GGGCAGGGGCGGGGTGAGGGTGGAGCTACCTCATGCCTCTCCTCCACCCGTCACT

5. Mediterranean 563 C/T
cDNA Nucleotide : 563 GC
Codon: Ser188Phe
Exon: 6
Variation ID: rs5030868


RefSeqGene Mapping: NG009015.2

Gene (ID): 2539

F_inner(G): 5’-ACCGGCTGTCCAACCACATATC-3’
R_inner(C): 5’-CCTCACGGAACAGGGCGA-3’
F_common: 5’-CACATGAATGCCCTCCACCTG-3’
R_common: 5’-CCAAAGGGCTCCTTGAAGGTG-3’

Position: 18154

22
18
21
21

54.5
66.7
57.1
57.1

63.2
62.3
61.9
61.8

22
19
22
22

54.5
57.9
54.5
54.5

62.7
69.3
62.8
62.9

20
21
25
26

65.0
57.1
48.0
38.5

62.0
62.4
63.6
59.6

21
19
23
23

52.4
63.2
47.8
56.5

61.2
62.4
61.7
63.0

M-Product: 185 bp
N-Product: 211 bp
Common: 356 bp

6. Mahidol 487 G/A
cDNA Nucleotide: 487 GA
Codon: Gly163Ser
Exon: 6
Variation ID: rs137852314Position: 18078
F_inner(G): 5’- GAGTCCTGCATGAGCCAGAGAA-3’
R_inner(A): 5’- CGATGATGCGGTTCCATCC-3’
F_common: 5’- GGTGACCTGGCCAAGAAGAAGA-3’
R_common: 5’- TAGGTGGTTCTGCATCACGTCC-3’
M-Product: 328 bp
N-Product: 385 bp
Common: 672 bp

7.Coimbra 592C/T
cDNA Nucleotide: 592 CT
gDNA : 11763
Codon: Arg198Leu
Exon: 6
Class II
Variation ID: rs137852330

Position: 18183

F_inner(C): 5’-CCGTGAGGACCAGATCTCCC-3’
R_inner(T): 5’-GCCCAGGTAGTGGTCGATTCA-3’
F_common: 5’-GTCACCAAGAACATTCACGAGTCCT-3’
R_common: 5’-GATGATCCCAAATTCATCGAAATAGC-3’
M-Product: 197 bp
N-Product: 165 bp
Common: 321 bp

8.Vanua Lava 592C/T
cDNA Nucleotide: 592 CT
gDNA : 10884
Codon: Leu127Pro
Exon: 5
Class II
Variation ID: rs1050829 (????)

Position: 17303

F_inner(C): 5’-CAACAGCCACATGAATGCACC-3’
R_inner(T): 5’-GCCTGTGACCCCAGGTTGA-3’
F_common: 5’-TGGCCAAGAAGAAGATCTACCCC-3’
R_common: 5’-GGTAGTGGTCGATGCGGTAGATC-3’


M-Product: 274 bp
N-Product: 246 bp
Common: 480 bp

9. BaoLoc 352 T/C
cDNA Nucleotide: 352 TC
gDNA: 10853
Codon: Tyr118His
Exon: 5
Class II
Variation ID: rs1050829(?????)

Position:

F_inner(T): 5’-GCCAGTACGATGATGCAGCCTACT-3’
R_inner(C): 5’-GGCTGTTGAGGCGCTGTTG-3’
F_common: 5’-GGGTGACCTGGCCAAGAAGAA-3’
R_common: 5’-AGGTAGTGGTCGATGCGGTAGATCT-3’

24
19
21
25

54.2
63.2
57.1
52.0

65.2
62.8
62.9
65.3

M-Product: 251 bp
N-Product: 281 bp
Common: 489 bp

Primer được kiểm tra tính đặc hiệu trên NCBI/Blast

II. Kế hoạch làm việc trong tuần (những công việc được giao và những kế hoạch do cá nhân
đề ra)

STT

Công việc

1

Chỉnh sửa lại các primer đã thiết kế

2

Thiết kế cho Multiplex PCR theo thứ tự:
1. ViangChan; 2. Kaiping; 3. Canton; 4. Union; 5. Mediterranean; 6.
Coimbra; 7. Mahidol; 8. Vanua Lava; 9. BaoLoc.

Ghi chú

3
III. Một số kiến nghị, góp ý, sáng kiến, đề xuất trình ban lãnh đạo xem xét
…………………………………………………………………………………………………
………………………………………………………………………
IV. Nhận xét, góp ý và chỉ đạo của TGĐ
…………………………………………………………………………………………………
…………………………………………………………………………………………………
………………………………………………………………………………………………….
Hà Nội, Ngày 29 tháng 9 năm 2014
Người báo cáo
Vũ Anh Tuấn



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×

×