Tải bản đầy đủ

Nghiên cứu đặc điểm nhiễm orientia tsutsugamushi, ấu trùng mò tại khu vực tây bắc và chế tao bộ sinh phẩm phát hiện (tt)

BỘ GIÁO DỤC VÀ ĐÀO TẠO
BỘ Y TẾ
VIỆN SỐT RÉT - KÝ SINH TRÙNG - CÔN TRÙNG TRUNG ƯƠNG
-------------------***-------------------

TRẦN QUANG PHỤC

NGHIÊN CỨU ĐẶC ĐIỂM NHIỄM Orientia tsutsugamushi,
ẤU TRÙNG MÒ TẠI KHU VỰC TÂY BẮC
VÀ CHẾ TẠO BỘ SINH PHẨM PHÁT HIỆN

Chuyên ngành: Ký sinh trùng y học
Mã số: 62.72.01.16

TÓM TẮT LUẬN ÁN TIẾN SỸ Y HỌC

Hà Nội - 2019


CÔNG TRÌNH ĐÃ ĐƯỢC HOÀN THÀNH TẠI
VIỆN SỐT RÉT - KÝ SINH TRÙNG - CÔN TRÙNG TRUNG ƯƠNG


Cán bộ hướng dẫn khoa học:
1. PGS. TS. Nguyễn Văn Ba
2. PGS. TS. Lê Thành Đồng

Phản biện 1:
Phản biện 2:
Phản biện 3:

Luận án được bảo vệ trước Hội đồng chấm luận án cấp Viện
Tại Viện Sốt rét - Ký sinh trùng - Côn trùng Trung ương
Vào hồi ….. giờ ….., ngày ….. tháng ….. năm …..

Có thể tìm hiểu luận án tại:
1. Thư viện Quốc gia
2. Thư viện Viện Sốt rét - Ký sinh trùng - Côn trùng Trung ương


1
ĐẶT VẤN ĐỀ
Bệnh sốt do ấu trùng mò (thường được gọi là bệnh sốt mò) là một bệnh truyền
nhiễm cấp tính do tác nhân Orientia tsutsugamushi gây ra, bệnh có ổ dịch thiên nhiên,
truyền sang người khi bị ấu trùng mò đốt. Bệnh gặp chủ yếu ở vùng nông thôn, rừng
núi. Triệu chứng của bệnh sốt mò có thể nhầm với triệu chứng của nhiều loại bệnh
khác có các phác đồ điều trị khác nhau (như bệnh sốt xuất huyết dengue, bệnh sốt
xoắn khuẩn vàng da). Tỷ lệ tử vong cao nếu không được chẩn đoán kịp thời và dùng
kháng sinh đặc hiệu. Do vậy, việc phát hiện bệnh sớm có vai trò quyết định trong điều
trị bệnh sốt mò [5], [42], [133].
Ở Việt Nam, hiện nay có rất ít các phương tiện kỹ thuật chẩn đoán sốt mò, đặc
biệt là ở vùng sâu, vùng xa nơi có nguồn lực y tế còn hạn chế. Với sự phát triển mạnh
mẽ của lĩnh vực sinh học phân tử, nhiều công cụ hiện đại nhằm xác định và chẩn đoán
mầm bệnh đã được ứng dụng. Trong đó, phương pháp khuếch đại acid nucleic đẳng
nhiệt Recombinase Polymerase Amplification (RPA) có nhiều ưu điểm nổi bật so với
các kỹ thuật sinh học phân tử truyền thống, nhất là cho phép khuếch đại ở nhiệt độ
thấp (37 - 420C), thời gian phản ứng để xác định mẫu rất ngắn (5 - 20 phút). Phương
pháp RPA cho phép khuếch đại acid nucleic không cần sử dụng các hệ thống máy
luân nhiệt đắt tiền, cồng kềnh và hoạt động không ổn định trong điều kiện thực địa,
thiếu thốn các nguồn lực. Trong khi đó, độ nhạy của phương pháp RPA được đánh
giá là tương đương hoặc tốt hơn phương pháp PCR. Các trang thiết bị dễ dàng sử
dụng, vận chuyển đến ngay tại nơi lấy mẫu bệnh phẩm [64], [97], [140].
Vùng Tây Bắc nước ta là khu vực có điều kiện kinh tế - xã hội khó khăn, vùng có
nhiều đồng bào dân tộc thiểu số sinh sống. Điều kiện tự nhiên của khu vực thuận lợi
cho sự phát triển của nhiều ổ bệnh tự nhiên, trong đó có bệnh sốt mò. Trong những
năm qua, đã có một số nghiên cứu về trung gian truyền bệnh sốt mò ở các tỉnh khu
vực Đông Bắc [8], [12], [13] nhưng chưa có nghiên cứu nào được triển khai ở khu
vực Tây Bắc. Vì vậy, rất cần các nghiên cứu xác định các đặc điểm của ổ bệnh tự
nhiên và tỷ lệ người có kháng thể kháng Orientia tsutsugamushi ở cộng đồng nhằm
tăng cường hiệu quả phòng chống bệnh sốt mò cho khu vực Tây Bắc.
Xuất phát từ những vấn đề trên, “Nghiên cứu đặc điểm nhiễm Orientia
tsutsugamushi, ấu trùng mò tại khu vực Tây Bắc và chế tạo bộ sinh phẩm phát
hiện” được triển khai nhằm các mục tiêu:
1) Mô tả một số đặc điểm nhiễm Orientia tsutsugamushi, ấu trùng mò và đặc điểm
phân bố bệnh sốt mò tại khu vực Tây Bắc năm 2016 - 2017.
2) Chế tạo được bộ sinh phẩm phát hiện Orientia tsutsugamushi bằng kỹ thuật
khuếch đại đẳng nhiệt Recombinase Polymerase Amplification quy mô phòng thí
nghiệm.


2
TÍNH MỚI, TÍNH KHOA HỌC VÀ TÍNH THỰC TIỄN
1. Tính mới
Đây là lần đầu tiên sử dụng công nghệ khuếch đại đẳng nhiệt Recombinase
polymerase amplification để sản xuất được bộ sinh phẩm chẩn đoán bệnh sốt mò tại
Việt Nam. Đây là phương pháp xét nghiệm có độ nhạy, độ đặc hiệu cao, cho kết quả
nhanh (chỉ sau 20 phút), không cần tách chiết mẫu, không cần máy luân nhiệt hay các
trang bị phức tạp đi kèm do vậy rất tiện dụng và thích hợp để triển khai tại thực địa.
Nghiên cứu đã đánh giá được thực trạng người phơi nhiễm với tác nhân gây bệnh
sốt mò O.tsutsugamushi, về trung gian truyền bệnh sốt mò và tỷ lệ nhiễm
O.tsutsugamushi ở trung gian truyền bệnh tại 4 tỉnh Tây Bắc là Hòa Bình, Sơn La,
Điện Biên và Lai Châu.
2. Tính khoa học
Đề tài sử dụng phương pháp nghiên cứu khoa học chuẩn mực như:
- Nghiên cứu dịch tễ học mô tả có phân tích với các đợt điều tra cắt ngang để
nghiên cứu đặc điểm nhiễm Orientia tsutsugamushi, vật chủ và trung gian truyền bệnh
sốt mò; Nghiên cứu hồi cứu có phân tích đặc điểm phân bố bệnh sốt mò từ hồ sơ bệnh
nhân sốt mò lưu tại 4 bệnh viện tuyến tỉnh.
- Nghiên cứu labo: Xây dựng quy trình và chế tạo bộ sinh phẩm phát hiện O.
tsutsugamushi tại phòng thí nghiệm bằng công nghệ khuếch đại đẳng nhiệt RPA.
Nghiên cứu đánh giá, phân tích độ nhạy, độ đặc hiệu, độ ổn định của sản phẩm.
Đây là các phương pháp nghiên cứu chuẩn mực, hiện đại đang áp dụng tại Việt
Nam và thế giới nên có độ tin cậy cao. Ngoài ra, đề tài sử dụng các kỹ thuật hiện đại
như: Kỹ thuật chuyển nạp gen thông qua các plasmid, kỹ thuật khuyếch đại gen PCR,
đây là các kỹ thuật hiện đại có độ tin cậy cao.
3. Tính thực tiễn
Kết quả nghiên cứu của đề tài cung cấp cho ngành y tế một công cụ chẩn đoán
mầm bệnh sốt mò nhanh, chính xác và rất phù hợp với tuyến y tế cơ sở góp phần làm
giảm gánh nặng bệnh tật cho cộng đồng. Mặt khác, đề tài cũng cung cấp một tài liệu
tham khảo dùng trong nghiên cứu khoa học và giảng dạy tại các trường đại học, đồng
thời cũng là cơ sở cho các nghiên cứu tiếp theo.
CẤU TRÚC CỦA LUẬN ÁN
Luận án gồm 121 trang: Đặt vấn đề (2 trang), chương 1. Tổng quan tài liệu (35
trang), chương 2. Đối tượng và phương pháp nghiên cứu (23 trang), chương 3. Kết
quả nghiên cứu (34 trang), chương 4. Bàn luận (24 trang), Kết luận (2 trang), Kiến
nghị (1 trang), 33 bảng, 17 hình, 150 tài liệu tham khảo.
Chương 1.
TỔNG QUAN TÀI LIỆU
1.1. Đặc điểm bệnh sốt mò
Bệnh sốt do ấu trùng mò (bệnh sốt mò) là bệnh truyền nhiễm cấp tính thuộc nhóm
C trong Luật Phòng, chống bệnh truyền nhiễm. Bệnh do tác nhân O. tsutsugamushi
gây nên [2], [4], [141]; trung gian truyền bệnh là ấu trùng mò Leptotrombidium.


Bệnh có đặc điểm lâm sàng là sốt kéo dài 2 - 3 tuần, kèm theo có vết loét ở da,


3
nổi hạch toàn thân và nổi ban. Nếu không được điều trị bệnh sẽ có những biến chứng
nặng, tổn thương nhiều cơ quan nội tạng dễ dẫn đến tử vong. Nếu không được chẩn
đoán kịp thời để điều trị kháng sinh đặc hiệu, tỷ lệ tử vong từ có thể từ 7 - 10% [141],
thậm chí lên tới 70% tùy theo vùng dịch tễ khác nhau [40], [136].
1.1.1. Triệu chứng bệnh sốt mò
Ca bệnh lâm sàng: Ủ bệnh, trung bình 8 - 12 ngày (6 đến 21 ngày); Lúc đầu tại
nơi ấu trùng mò đốt có một nốt phỏng nước kích thước khoảng 2 - 5mm, không đau
[3], bệnh nhân thường không chú ý; sau thời gian ủ bệnh, bệnh phát ra với những triệu
chứng sau:
Sốt ≥ 38 - 400C, liên tục, kéo dài 15 - 20 ngày, có trường hợp sốt tới 27 ngày nếu
không điều trị; Có khi rét run 1 - 2 ngày đầu, kèm theo sốt là nhức đầu nặng, đau mỏi
cơ [4], [19].
Nốt loét đặc trưng (điển hình của sốt mò): Ở Việt Nam, tại nhiều ổ dịch tỷ lệ có
vết loét khá phổ biến, khoảng 80%, số còn lại có thể là những chấm nhỏ hoặc có vị trí
kín đáo khó phát hiện (như trong ống tai, âm hộ,...). Vết loét gặp nhiều nhất ở các
vùng da mềm và ẩm như bộ phận sinh dục, vùng hậu môn, bẹn, nách, cổ, rồi đến các
vùng khác như đùi, bụng, ngực, lưng. Đôi khi vết loét ở vị trí bất ngờ trong vành tai,
rốn, mi mắt (dễ nhầm với lẹo mắt). Đặc điểm của vết loét thường không đau, không
ngứa; người bệnh thường chỉ có một nốt, nốt hình tròn hoặc bầu dục đường kính từ 1
đến 20 mm; nốt phỏng ban đầu phát triển dần thành dịch đục trên một nền sẩn đỏ, sau
4 - 5 ngày vỡ thành một nốt có vẩy nâu nhạt hoặc đen tùy vào vùng da mềm hay cứng
và độ non hay già của nốt loét; sau một thời gian, vẩy bong để lộ nốt loét lõm đáy
nông, hồng nhạt, không mủ, không tiết dịch, bờ viền hồng đỏ hoặc thâm tùy theo bệnh
đang phát triển hay đã lui; từ khi hết sốt nốt loét liền dần [4], [19].
Hạch và ban dát sẩn: Hạch khu vực nốt loét thường sưng và đau, không đỏ, vẫn
di động, xuất hiện cùng với sốt hoặc sau 2 - 3 ngày, là chỉ điểm tìm nốt loét; Hạch
toàn thân sưng đau nhẹ hơn, trừ những ca nặng. Ban dát sẩn mọc cuối tuần thứ nhất
đầu tuần thứ hai, mọc khắp người, trừ lòng bàn tay bàn chân, tồn tại vài giờ đến 1
tuần, thưa hơn so với sốt Dengue cổ điển, khoảng 35 - 70% số bệnh nhân xuất hiện
ban, tùy thời điểm bệnh nhân được khám; đôi khi có đốm xuất huyết (dưới 10%).
Trong những ngày đầu, da và niêm mạc xung huyết ở đa số các trường hợp (khoảng
88%), khác với sốt rét và thương hàn [5], [71], [115].
Ở bệnh nhân nặng hay gặp tiếng tim mờ, huyết áp thấp, mạch chậm, chảy máu
cam, xuất huyết tiêu hóa, viêm phế quản, viêm phổi không điển hình [37], [146].
Ngoài ra, sốt mò còn có thể ẩn và thể không điển hình (không có nốt loét).
Nếu được điều trị bằng kháng sinh thích hợp, sẽ cắt sốt nhanh. Nếu can thiệp
muộn hoặc không hiệu quả, có thể có biến chứng như viêm cơ tim, sốc nhiễm khuẩn,
viêm phổi, suy hô hấp, viêm não - màng não... dẫn đến tử vong [39], [102].
Tỷ lệ tử vong do O. tsutsugamushi khác nhau ở từng nước, phụ thuộc vào chủng
lưu hành ở địa phương. Ở Việt Nam, tỷ lệ tử vong khoảng 1%; Indonesia và Đài Loan
5-20%, Malaysia 15 - 20%, Nhật Bản 20 - 60% [5], [134].
1.1.2. Chẩn đoán bệnh sốt mò
Chẩn đoán bệnh sốt mò dựa vào tiêu chuẩn lâm sàng và xét nghiệm.


4
Tiêu chuẩn xác định bệnh [5]:
- Chỉ cần một tiêu chuẩn lâm sàng
+ Sốt, vết loét đặc trưng, có thể hạch sưng đau, ban dát sẩn, bạch cầu 4.000 12.000, Lympho bình thường hoặc tăng, máu lắng tăng.
+ Chỉ tiêu bắt buộc: Phải có vết loét đặc trưng.
- Nếu không có vết loét đặc trưng, bắt buộc phải có một test sau đây dương tính:
Test xét nghiệm hấp phụ miễn dịch gắn men (IgM ELISA); hoặc xét nghiệm kháng
thể miễn dịch huỳnh quang gián tiếp (test IFA); hoặc xét nghiệm kháng thể miễn dịch
peroxidase gián tiếp (test IIP).
- Phản ứng Weil-Felix với kháng nguyên OX-K của vi khuẩn Proteus mirabilis,
độ nhạy và độ đặc hiệu không cao nhưng rẻ tiền, phù hợp với tuyến huyện.
- Test điều trị thử: Để giải quyết sớm bệnh nhân nên dùng thử tetracycline hay
chlorocid, chỉ có giá trị chẩn đoán nghi ngờ [5], [119], [137].
Chẩn đoán phân biệt: Bệnh do xoắn khuẩn; Thương hàn; Sốt Dengue; Sốt rét.
Điều trị bệnh sốt mò
Kháng sinh đặc hiệu điều trị bệnh sốt mò là chloramphenicol, doxycycline và
tetracycline. Tuy nhiên, do các kháng sinh này không có tác dụng diệt vi khuẩn mà
chỉ có tác dụng hãm khuẩn nên vi khuẩn O. tsutsugamushi vẫn sống và tồn tại trong
hạch bạch huyết, ở hệ võng nội mô trong nhiều ngày, nhiều tháng và dễ tái phát bệnh
[5], [26], [30].
1.1.3. Phòng bệnh sốt mò
Thực hiện các biện pháp tuyền truyền giáo dục sức khỏe kết hợp vệ sinh phòng
bệnh.
Điều tra cơ bản phát hiện ổ dịch ở địa bàn nghi ngờ và có người ở để xử lý (bắt
thú nhỏ gặm nhấm, bắt mò, phân loại, phân lập R.orientalis, tìm kháng thể, phát hiện
bệnh nhân).
Tại ổ dịch đã xác định hoặc nghi ngờ: Biện pháp ngăn ngừa mò đốt: Diệt mò ở
môi trường: phun tồn lưu vào đất ẩm, bờ bụi cây cỏ cao dưới 20 cm quanh nhà nơi
dâm mát thuốc diazinon, fenthion, malathion, lindane, dieldrin, chlordan. Diệt chuột
theo mùa, chú ý rắc thuốc diệt mò trước. Phát quang thảm thực vật quanh nhà chọn
lọc các đám thực vật có nhiều ấu trùng mò (đảo mò). Điều trị dự phòng: Biện pháp
này hạn chế vì nhiễm bệnh tại ổ dịch không dễ dàng; có thể sử dụng khi có đơn vị bộ
đội phải vượt qua ổ dịch đi làm nhiệm vụ, dùng Doxycycline 200 mg/tuần [4], [5],
[19].
1.2. Các kỹ thuật sinh học phân tử chẩn đoán bệnh sốt mò
Các xét nghiệm huyết thanh học để phát hiện kháng thể Orientia tsutsugamushi
không phù hợp để chẩn đoán bệnh trong giai đoạn cấp vì nồng độ kháng thể có thể
dưới ngưỡng phát hiện trong giai đoạn bệnh khởi phát. Do đó, việc phát hiện kháng
nguyên/mầm bệnh trước khi nồng độ kháng thể đặc hiệu tăng lên là rất quan trọng.
Hầu hết các xét nghiệm phát hiện kháng nguyên/mầm bệnh hiện nay dựa vào phương
pháp PCR, realtime PCR định lượng hay nested PCR nhắm vào các gen đích khác
nhau, bao gồm 56 kDa, 47 kDa, groEL của Orientia tsutsugamushi [47], [74], [94].
Tuy nhiên, tất cả các xét nghiệm này đòi hỏi phải đào tạo để vận hành máy luân nhiệt
PCR, và trong điều kiện với nguồn lực hạn chế thì việc trang bị, bảo dưỡng, căn chỉnh


5
máy luân nhiệt đảm bảo hoạt động ổn định là rất khó khăn.
Công nghệ mới khuếch đại acid nucleic:
Xét nghiệm phân tích acid nucleic hứa hẹn mang lại công cụ chẩn đoán nhanh,
nhạy và đặc hiệu đối với các bệnh ký sinh trùng. Các thiết bị chẩn đoán thế hệ mới
cho phép phát hiện các mầm bệnh ký sinh trùng ngay tại thực địa, cho phép các nhà
lâm sàng nhanh chóng đưa ra chẩn đoán tin cậy để có biện pháp điều trị hiệu quả. Bản
chất sinh hoá phức tạp của các mẫu bệnh phẩm lâm sàng, nồng độ thấp của acid
nucleic trong hầu hết các mẫu bệnh phẩm và công nghệ cảm biến sinh học hiện tại đòi
hỏi chúng ta phải dùng đến một số công nghệ khuếch đại acid nucleic để cải thiện độ
nhạy, đáp ứng được các yêu cầu trong lâm sàng khi phân tích các mẫu nhỏ, áp dụng
trong phân tích mẫu tại thực địa [97], [141].
Hầu hết các công nghệ phân tích acid nucleic hiện nay có giá thành rất cao và cần
người làm xét nghiệm được đào tạo, do vậy chỉ phù hợp với các phòng thí nghiệm ở
trung tâm được đầu tư nhiều với nguồn lực dồi dào ở các thành phố và đô thị lớn. Điều
này khiến những lợi ích của xét nghiệm phân tích acid nucleic không đến được với
những cư dân sinh sống ở những vùng có nguồn lực hạn chế và ở các khu vực địa lý
biệt lập. Bởi vậy, công nghệ chẩn đoán phân tử với giá thành hợp lý, không quá phức
tạp là hết sức cần thiết để bảo vệ sức khoẻ của từng cá nhân và cộng đồng. Những tiến
bộ khoa học kỹ thuật gần đây cho thấy các trang thiết bị phân tích acid nucleic có thể
được thu nhỏ, dễ dàng vận chuyển xuống thực địa .
Để khắc phục những giới hạn của phương pháp PCR truyền thống trong kỷ
nguyên khuếch đại acid nucleic dùng trong chẩn đoán phân tử tại thực địa, các nghiên
cứu gần đây có xu hướng chuyển sang các phương pháp khuếch đại acid nucleic đẳng
nhiệt. Các phương pháp khuếch đại đẳng nhiệt sử dụng các enzyme để thực hiện bước
tách sợi, khác với phương pháp PCR truyền thống buộc phải sử dụng nhiệt độ cao.
Những kỹ thuật khuếch đại đẳng nhiệt là công cụ rất hữu ích để phát triển các mô hình
chẩn đoán tại thực địa có khả năng khuếch đại acid nucleic mà không cần các bước
luân nhiệt và các cơ chế điều khiển liên quan [109], [111].
Công nghệ khuếch đại đẳng nhiệt Recombinase polymerase amplification
Recombinase polymerase amplification (RPA) là công nghệ sử dụng hỗn hợp các
recombinase của sinh vật tiền nhân để giúp các primer gắn đặc hiệu vào gen đích.
Enzyme ADN polymerase thay thế sợi (tiểu phần lớn của Bacillus subtilis PolI, Bsu)
xúc tác phản ứng kéo dài primer để tổng hợp sợi ADN mới bổ sung [49].
Điểm quan trọng trong RPA là việc sử dụng enzyme recombinase và phân tử SSB
để thay thế cho bước biến tính trong PCR truyền thống. Kỹ thuật RPA đã phát huy tối
đa những ưu thế về tính đơn giản, tiết kiệm chi phí và thời gian phản ứng rất ngắn. Để
xác định trình tự mục tiêu, RPA yêu cầu 2 mồi oligonucleotide được thiết kế đơn giản
(có thể cần thêm 1 probe) để phản ứng bắt cặp xảy ra. Phương pháp có độ đặc hiệu
trình tự cao trong hỗn hợp acid nucleic mà không cần tách chiết mẫu. Công nghệ này
cho phép khuếch đại gen đích bằng cách tổng hợp liên tục ADN mà không cần biến
tính sợi kép ADN ở nhiệt độ cao. Xét nghiệm có thể được tiến hành trong khoảng
nhiệt độ từ 24°C đến 45°C với hiệu suất rất cao nhờ đó có thể phát hiện được tín hiệu
từ đơn phân tử đích chỉ sau 5 - 20 phút, rất ngắn so với PCR truyền thống (20 - 180
phút), Reltime PCR (3 - 4 giờ) và LAMP (45 - 60 phút). Công nghệ RPA đã được


6
phát triển để phát hiện HIV, Rift Valley Fever virus, virus Ebola, Sudan và Marburg,
MERS-CoV, virus gây bệnh chân tay miệng và Coronavirus ở bò. Kỹ thuật cũng đã
được phát triển để phát hiện Chlamydia trachomatis trong các mẫu nước tiểu, chẩn
đoán Cryptosporidiosis ở động vật và mẫu bệnh phẩm ở người và phát hiện Neisseria
gonorrhoeae, Salmonella enterica, Staphylococcus aureus kháng methicillin (MRSA),
Francisella tularensis, và Streptococci nhóm B [81], [93], [105].
Độ nhạy và độ đặc hiệu của kỹ thuật RPA cũng rất cao. Các nghiên cứu cho thấy,
công nghệ RPA có thể phát hiện được 1 bản sao của mẫu ADN đích (hoặc <10 bản
sao của mẫu ARN) trong mẫu mà không cần đòi hỏi quá cao về độ tinh sạch của mẫu.
Một số thử nghiệm cho thấy, RPA có thể xác định và nhân bản được đoạn acid nucleic
mục tiêu trong mẫu chứa rất nhiều vật chất di truyền của các loài động vật khác nhau.
Trong y tế, kỹ thuật này có thể được áp dụng một cách linh hoạt nhằm phát hiện trực
tiếp và nhanh chóng một số mầm bệnh từ các mẫu bệnh phẩm như máu, dịch tiết, chất
thải và tổ chức mô, trong khi hầu hết các phương pháp chẩn đoán hiện nay đều yêu
cầu xử lý mẫu với kiềm yếu để giải phóng vật chất di truyền [58], [139].
Chính vì vậy, kỹ thuật RPA với việc có thể khắc phục một cách cơ bản nhược
điểm của những kỹ thuật huyết thanh, sinh học phân tử khác đã trở thành một trong
những phương pháp được quan tâm áp dụng hiện nay trong chẩn đoán, xác định tác
nhân của nhiều loại bệnh và trên nhiều đối tượng.
Chương 2.
ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng, địa điểm và thời gian nghiên cứu
2.1.1. Đối tượng nghiên cứu
- Đối tượng nghiên cứu đặc điểm nhiễm Orientia tsutsugamushi, ấu trùng mò:
Người dân tại điểm nghiên cứu. Các loài chuột tại điểm nghiên cứu. Trung gian truyền
bệnh là ấu trùng mò.
- Đối tượng nghiên cứu đặc điểm phân bố bệnh sốt mò: Hệ thống sổ sách, bệnh án
các trường hợp mắc bệnh sốt mò đến khám và điều trị tại các bệnh viện đa khoa 4 tỉnh
Sơn La, Điện Biên, Lai Châu và Hòa Bình. từ ngày 01/01/2016 đến ngày 31/12/2017.
- Đối tượng nghiên cứu chế tạo bộ sinh phẩm (kit) phát hiện O. tsutsugamushi:
+ Mẫu bệnh dương tính với O. tsutsugamushi (nhóm bệnh);
+ Mẫu bệnh âm tính với O. tsutsugamushi (nhóm chứng); Mẫu bệnh phẩm
dương tính với một số loài vi khuẩn có thể gây triệu chứng bệnh tương tự như O.
tsutsugamushi.
+ Bộ sinh phẩm phát hiện O. tsutsugamushi được chế tạo.
2.1.2. Địa điểm nghiên cứu
- Nghiên cứu được triển khai tại 4 tỉnh thuộc khu vực Tây Bắc, gồm: Sơn La,
Điện Biên, Lai Châu và Hòa Bình. Đây là những tỉnh có điều kiện sinh địa cảnh thuận
lợi cho mò phát triển, điều kiện kinh tế - xã hội còn nhiều khó khăn, vùng đồng bào
dân tộc thiểu số, có ghi nhận số bệnh nhân mắc bệnh sốt mò cao trong những năm
trước đây và là vùng trọng điểm về chính trị, an ninh, quốc phòng.
- Viện Nghiên cứu Y - Dược học quân sự, Học viện Quân y.


7
2.1.3. Thời gian nghiên cứu
Nghiên cứu được thực hiện từ 01/2016 đến 6/2018.
Nghiên cứu dịch tễ học mô tả có phân tích bằng điều tra cắt ngang tại cộng đồng.
Nghiên cứu hồi cứu có phân tích đặc điểm phân bố bệnh sốt mò từ hồ sơ bệnh
nhân sốt mò lưu tại 4 bệnh viện tuyến tỉnh.
2.2. Phương pháp nghiên cứu
2.2.1. Thiết kế nghiên cứu
- Nghiên cứu dịch tễ học mô tả có phân tích bằng điều tra cắt ngang tại cộng đồng.
- Nghiên cứu hồi cứu.
- Nghiên cứu labo: Quy trình chế tạo bộ sinh phẩm phát hiện O. tsutsugamushi tại
phòng thí nghiệm.
- Nghiên cứu đánh giá, phân tích độ nhạy, độ đặc hiệu, độ ổn định của sản phẩm.
2.2.2. Cỡ mẫu nghiên cứu
- Cỡ mẫu điều tra cộng đồng dân cư: Sử dụng công thức sau:
(1  p)
n  Z2
1 α 2
pε2
Trong đó: n: Cỡ mẫu nghiên cứu. p = 0,2104 (Tỷ lệ ước tính quần thể - 21,04%)
[34]; α = 0,05 (Mức ý nghĩa thống kê); Z 1- α/2 = 1,96 (Tương ứng α = 0,05). Cỡ mẫu
yêu cầu tối thiểu 1.442 người. Thực tế đã điều tra 1.520 người.
- Cỡ mẫu điều tra hồi cứu bệnh nhân sốt mò:
Toàn bộ bệnh nhân được chẩn đoán sốt mò điều trị tại bệnh viện đa khoa của 4
tỉnh Hòa Bình, Sơn La, Điện Biên và Lai Châu từ 01/01/2016 - 31/12/2017 đạt tiêu
chuẩn nghiên cứu. Thực tế đã chọn được 230 bệnh án đáp ứng tiếu chuẩn nghiên cứu
(lâm sàng và vết loét đặc trưng).
- Cỡ mẫu điều tra vật chủ và trung gian truyền bệnh:
Áp dụng công thức sau:
p(1  p)
n  Z2
1 α 2
d2
Trong đó: n: Cỡ mẫu nghiên cứu; p = 0,125 (Tỷ lệ ước tính quần thể - Theo
tác giả Đoàn Trọng Tuyên [34]; α = 0,05 (Mức ý nghĩa thống kê); Z 1- α/2 = 1,96 (Tương
ứng α = 0,05); d = 0,02 (Sai số tuyệt đổi). Cỡ mẫu tối thiểu là 1.050. Thực tế, nhóm
nghiên cứu đã bắt được và nghiên cứu 1.707 con chuột tại 4 tỉnh nghiên cứu.
- Cỡ mẫu đánh giá độ nhạy, độ đặc hiệu, độ ổn định bộ kit
+ Chế tạo 500 test phát hiện Orientia tsutsugamushi bằng công nghệ khuếch đại
đẳng nhiệt RPA.
+ Mẫu bệnh phẩm (+) với Orientia tsutsugamushi (nhóm bệnh): 37 mẫu.
+ Mẫu bệnh phẩm (-) với Orientia tsutsugamushi (nhóm chứng): 100 mẫu.
+ Mẫu bệnh phẩm dương tính với một số loài vi khuẩn có thể gây triệu chứng
bệnh tương tự như Orientia tsutsugamushi: 13 mẫu.
2.3. Các kỹ thuật được sử dụng trong nghiên cứu
- Kỹ thuật lấy, bảo quản mẫu xét nghiệm huyết thanh
- Kỹ thuật xét nghiệm ELISA phát hiện kháng thể kháng O. tsutsugamushi trên
người.


8
- Kỹ thuật bẫy thu thập chuột và định loại.
- Kỹ thuật xét nghiệm tìm kháng thể kháng O. tsutsugamushi trên chuột (SD
BIOLINE Tsutsugamushi test).
- Kỹ thuật thu thập ấu trùng mò.
- Kỹ thuật định loại mò.
- Kỹ thuật phỏng vấn cộng đồng.
- Các kỹ thuật chuẩn sử dụng để tách dòng gen, PCR và điện di phân tích ADN,
giải trình tự gen, realtime PCR, kỹ thuật khuếch đại đẳng nhiệt RPA.
2.4. Phương pháp xử lý số liệu
Số liêu được nhập và xử lý bằng phần mềm thống kê SPSS 17.0.
2.5. Đạo đức trong nghiên cứu
Nghiên cứu tuân thủ đầy đủ các quy định trong nghiên cứu y sinh học.
Chương 3.
KẾT QUẢ NGHIÊN CỨU
3.1. Một số đặc điểm nhiễm Orientia tsutsugamushi, ấu trùng mò và phân bố bệnh
sốt mò tại khu vực Tây Bắc
3.1.1. Kết quả điều tra huyết thanh phát hiện kháng thể O. tsutsugamushi lưu
hành trong cộng đồng dân cư
Qua điều tra cắt ngang tại 30 xã của 4 tỉnh Hòa Bình, Sơn La, Điện Biên, Lai
Châu có 1.520 người được xét nghiệm huyết thanh phát hiện kháng thể kháng Orientia
tsutsugamushi, kết quả như sau:
Bảng 3.1. Tỷ lệ người có kháng thể kháng O. tsutsugamushi theo tỉnh
Mẫu điều tra
Tỉnh
Số mẫu (+)
Tỷ lệ (%)
p
(n)
Hòa Bình (1)
329
55
16,72
p1-2 <0,05
Sơn La (2)
431
39
9,05
p1-4 <0,05
p2-3 <0,05
Điện Biên (3)
437
63
14,42
p3-4 <0,05
Lai Châu(4)
323
28
8,67
Cộng
1520
185
12,17
Ghi chú: p1-2: giá trị p của (1) và (2).
Nhận xét: Kết quả tại bảng 3.1 cho thấy: Tỷ lệ người có kháng thể kháng
Orientia tsutsugamushi chung là 12,17%; Cao nhất ở Hòa Bình 16,72%, tiếp đến là
Điện Biên 14,42%. Hai tỉnh Sơn La và Lai Châu có tỷ lệ người có kháng thể kháng
Orientia tsutsugamushi thấp hơn (lần lượt là 9,05% và 8,67%). Sự khác biệt có ý nghĩa
thống kê, p <0,05


9
Bảng 3.3. Tỷ lệ người có kháng thể kháng O. tsutsugamushi theo tuổi
Mẫu xét nghiệm
Nhóm tuổi
Số mẫu (+)
Tỷ lệ (%)
p
(n)
≤ 20 tuổi
179
12
6,70
21-30
257
18
7,00
31-40
240
32
13,33
p4-1,2,3,5,6,7
41-50
226
52
23,01
<0,05
51-60
217
30
13,82
61-70
215
23
10,70
>70 tuổi
186
18
9,68
Cộng
1.520
185
12,17
Nhận xét: Tỷ lệ người bị nhiễm O. tsutsugamushi cao nhất ở nhóm 41 - 50
tuổi (23,01%), thấp nhất ở nhóm dưới 20 tuổi (6,7%).
Bảng 3.6. Tỷ lệ người có kháng thể kháng O. tsutsugamushi theo đặc điểm sinh cảnh
khu vực sinh sống
Mẫu điều
Vùng sinh thái
Số mẫu (+) Tỷ lệ (%)
p
tra (n)
Savan(1)
428
65
15,19
P1-2> 0,05
Rừng tái sinh(2)
670
94
14,03
P2-3< 0,05
Rừng nguyên sinh(3)
422
26
6,16
Cộng
1.520
185
12,17
Nhận xét: Tỷ lệ người có kháng thể kháng O. tsutsugamushi trong cộng đồng
dân cư sống trong các khu vực có đặc điểm sinh cảnh Savan và rừng tái sinh tương
ứng là 14,03% đến 15,19% cao hơn cộng đồng dân cư sống trong vùng rừng nguyên
sinh (6,16%) có ý nghĩa thống kê, p < 0,05.
3.3.2. Một số đặc điểm phân bố bệnh sốt mò
Kết quả thống kê hồi cứu hồ sơ bệnh án tại 4 bệnh viện đa khoa của 4 tỉnh
Hòa Bình, Sơn La, Điện biên, Lai Châu trong 2 năm (từ 01/01/2016-31/12/2017) đã
xác định được tổng số 230 bệnh nhân được chẩn đoán là sốt mò đáp ứng các tiêu
chuẩn nghiên cứu. Kết quả phân tích đánh giá như sau:
- Phân bố của bệnh nhân sốt mò theo địa phương
Số bệnh nhân tại 4 tỉnh nghiên cứu như sau:
Bảng 3.7. Phân bố của bệnh nhân sốt mò theo tỉnh
TT
Tỉnh
Số bệnh nhân
Tỷ lệ %
1
Hòa Bình
69
30,00
2
Sơn La
48
20,87
3
Điện Biên
78
33,91
4
Lai Châu
35
15,22
Cộng
230
100,00
Nhận xét: Trong số 230 bệnh nhân tại 4 tỉnh cho thấy: Tỉnh có số bệnh nhân
sốt mò nhiều nhất là Điện Biên (chiếm 33,91%), tiếp theo là Hòa Bình (30,00%), Sơn
La (20,87%), thấp nhất là Lai Châu (15,22%).


10
- Phân bố của bệnh nhân sốt mò theo giới và tuổi
Trong số 230 ca bệnh có 116 người là nam, chiếm 50,43%; 114 người là nữ,
chiếm 49,57%.
Bảng 3.8. Phân bố của bệnh nhân sốt mò theo lứa tuổi (n=230)
TT
Lứa tuổi
Số BN
Tỷ lệ %
1
≤ 20 tuổi
20
8,70
2
Từ 21 đến 30 tuổi
31
13,48
3
Từ 31 đến 40 tuổi
37
16,09
4
Từ 41 đến 50 tuổi
55
23,91
5
Từ 51 đến 60 tuổi
34
14,78
6
Từ 61 đến 70 tuổi
29
12,61
7
>70 tuổi
24
10,43
Tổng cộng
230
100,00
Nhận xét: Bệnh nhân sốt mò gặp rải rác ở tất cả các nhóm lứa tuổi. Trong đó,
lứa tuổi có số bệnh nhân sốt mò cao nhất là 41 - 50 tuổi (23,91%).
- Phân bố của bệnh nhân sốt mò theo tháng

13
94

10
46

Thá…

15

18
11
7

Thá…

30
15

Thá…

16

28
20
8

Thá…

34
18

Thá…

29
21
8

Chung 2 năm

Thá…

23
38
15

Thá…

64
2

Thá…

5 41 2 3
1

Thá…

16
8
Thá…

0

Năm 2017

Thá…

50
Thá…

Ca bệnh

Năm 2016

Hình 3.1: Phân bố của bệnh nhân sốt mò theo tháng
Nhận xét: Bệnh sốt mò xuất hiện vào tất cả các tháng trong năm, cao điểm là
từ tháng 5 đến tháng 10 (năm 2016) và từ tháng 5 đến tháng 9 (năm 2017) là các tháng
mùa mưa. Bệnh giảm thấp nhất vào tháng một và tháng hai hàng năm.
3.1.2. Kết quả điều tra vật chủ và trung gian truyền bệnh sốt mò
Tại 4 tỉnh nghiên cứu đã bẫy được 1.707 con chuột, trong đó có 703 con bắt
bằng bẫy trong nhà và 1.004 con bằng bẫy ngoài nhà. Kết quả định loại chuột, ấu
trùng mò, xét nghiệm phát hiện kháng thể kháng Orientia tsutsugamushi trên chuột
được trình bày bằng các bảng, hình sau:
Bảng 3.9. Số lượng và loài chuột điều tra tại các điểm nghiên cứu
Số lượng chuột (con)
TT Tên loài chuột
Hòa Bình
Sơn La
Điện Biên Lai Châu
TN NN TN NN TN
NN TN NN
1 Chuột nhắt
152
0
153 0
185
0
157
0
2 Chuột rừng
0
93
0
32
0
185
0
34
3 Chuột mốc
0
0
0 272
0
0
0
88
4 Chuột đất bé
0
62
0
0
56
238
0
0
5 Số chuột theo vị trí bẫy 152 155 153 304 241 423 157 122
Tổng số
307
457
664
279


11
Ghi chú: TN: Trong nhà; NN: Ngoài nhà
Nhận xét: Số lượng chuột bẫy được sau 10 đêm tại Hòa Bình là 307 con, Sơn
La là 457 con, Điện Biên là 664 con và tại Lai Châu là 279 con.
Bảng 3.11. Tỷ lệ chuột nhiễm ấu trùng mò tại các điểm nghiên cứu
Tỷ lệ chuột nhiễm ấu trùng mò (%)
Hòa Bình
Sơn La
Điện Biên
Lai Châu
TT Tên loài chuột
TN
NN
TN
NN
TN
NN
TN
NN
n=152 n=155 n=153 n=304 n=241 n=423 n=157 n=122
1 Chuột nhắt
13,16
9,80
13,51
14.65
2 Chuột rừng
95,70
0,00
89,19
5,88
3 Chuột mốc
96,32
88,64
4 Chuột đất bé
40,32
7,14 52,52
5 Nhiễm chung
43,65
60,61
48,04
38,71
Ghi chú: TN: Trong nhà, NN: Ngoài nhà
Nhận xét: Tỷ lệ nhiễm ấu trùng mò của các loài chuột sống gần rừng như
chuột rừng, chuột mốc cao hơn những loài sống gần nhà và trong nhà như chuột đất
bé và chuột nhắt. Loài chuột mốc ở Sơn La có tỷ lệ nhiễm ấu trùng mò 96,32%, ở Lai
Châu 88,64%. Loài chuột rừng ở Hòa Bình có tỷ lệ nhiễm ấu trùng mò 95,7%, ở Điện
Biên 89,19% và ở Lai Châu chỉ có 5,88%. Tỷ lệ chung của các loài chuột nhiễm ấu
trùng mò cao nhất tại Sơn La 60,61%, tiếp đến là Điện Biên 48,04%, tại Hòa Bình là
43,65% và thấp nhất là Lai Châu 38,71%.
Bảng 3.12. Định loại mò trên chuột tại các điểm nghiên cứu
Điểm nghiên cứu
TT Tên loài chuột
Hòa Bình
Sơn La
Điện Biên
Lai Châu
A.(L.) indica
A.(L,) indica
(1)
1 Chuột nhắt
0
0
G.(W.) ewingi
G.(W.) ewingi
A.(L.) indica
A.(L.) indica
2 Chuột rừng (2)
G.(W.) ewingi
G.(W.) ewingi
G.(W.) lupella
G.(W.) lupella
3 Chuột mốc (2)
4 Chuột đất bé (2)
A.(L.) indica
A.(L.) indica
Ghi chú: (1) Trong nhà; (2) Ngoài nương rẫy
Kết quả bảng trên cho thấy: Chuột ở các điểm nghiên cứu nhiễm từ 1 đến 3
loài mò, trong đó có 1 đến 2 loài mò có vai trò truyền bệnh sốt mò. Loài chuột rừng
(R. rattus) ở Hòa Bình và Điện Biên nhiễm 3 loài mò, trong đó 1 loài có vai trò truyền
bệnh sốt mò là A. (Lau.) indica. Chuột nhắt (Rattus exuians) ở Sơn La và Lai Châu
nhiễm 2 loài mò, trong đó 1 loài có vai trò truyền bệnh là A. (Lau.) indica. Chuột đất
bé (B. salivei) ở Hòa Bình và Điện Biên nhiễm 1 loài mò có khả năng truyền bệnh sốt
mò là A. (Lau.) indica.


12
Bảng 3.13. Thành phần loài mò tại từng điểm nghiên cứu
Tỷ lệ các loài mò (%)
TT
Tên loài mò
Hòa Bình Sơn La Điện Biên Lai Châu
(n=134) (n=277) (n=319) (n=108)
1 Ascoschoengastia (Laurentella)
70,90
51,62
66,46
55,56
indica
2 Garliepia (Walchia) ewingi
3,73
1,81
8,15
5,56
3 G. (W.) lupella
23,88
23,47
20,38
20,37
4 Leptotrombidim (Lep) deliense
1,49
23,10
5,02
18,52
Nhận xét: Tại 4 tỉnh khảo sát đều thu được 4 loài mò là Ascoschoengastia
(Laurentella) indica, Garliepia (Walchia) ewingi, G. (W.) lupella và Leptotrombidim
(Lep.) deliense. Trong đó có 2 loài mò có khả năng truyền bệnh sốt mò là
Leptotrombidim (Lep.) deliense và Ascoschoengastia (Laurentella) indica.
Bảng 3.14. Kết quả xét nghiệm huyết thanh phát hiện kháng thể kháng Orientia
tsutsugamushi trên chuột
Kháng thể kháng O. tsutsugamushi
T
T

Hòa Bình
Sơn La
Điện Biên
Lai Châu
Mẫu Tỷ lệ % Mẫu Tỷ lệ % Mẫu Tỷ lệ % Mẫu Tỷ lệ
XN
(+)
XN
(+)
XN
(+)
XN % (+)
1 Chuột nhắt
152 13,16 153
5,23
185
7,03
157 5,10
2 Chuột rừng
93
36,56
32
0,00
185 42,16
34
5,88
3 Chuột mốc
272 68,38
88 36,36
4 Chuột đất bé
62
20,97
294 15,99
Tổng cộng
307 21,82 457 42,45 664 20,78 279 15,77
Ghi chú: XN: Xét nghiệm
Nhận xét: Huyết thanh chuột ở cả bốn điểm đều có kháng thể kháng O.
tsutsugamushi.
Tại Hòa Bình: Các loài chuột có kháng thể kháng thể kháng O. tsutsugamushi
gồm chuột đất lắt (13,16%), chuột rừng (36,56%), chuột đất bé (20,97%). Tỷ lệ chuột
có kháng thể kháng O. tsutsugamushi chung là 21,82%.
Tại Sơn La: Các loài chuột có kháng thể kháng O. tsutsugamushi gồm chuột
đất lắt (5,23%), chuột mốc (68,38%). Tỷ lệ chuột có kháng thể kháng O.
tsutsugamushi chung là 42,45%.
Tại Điện Biên: Các loài chuột có kháng thể kháng O. tsutsugamushi gồm
chuột rừng (42,16%), chuột đất bé (15,99%) và chuột đất lắt (7,03%). Tỷ lệ có kháng
thể kháng Orientia tsutsugamushi chung là 20,78%.
Tại Lai Châu: Các loài chuột có kháng thể kháng Orientia tsutsugamushi
gồm chuột mốc (36,36%), chuột rừng (5,88%) và chuột nhắt (5,10%). Tỷ lệ có kháng
thể kháng Orientia tsutsugamushi chung là 15,77%.
3.2. Kết quả nghiên cứu chế tạo bộ sinh phẩm phát hiện Orientia tsutsugamushi
quy mô phòng thí nghiệm
Loài chuột


13
Qua 10 bước cơ bản theo hình sau:
Thiết lập chứng dương (1)

Tối ưu điều kiện phản ứng
khuếch đại acid nucleic (2)

Xác định độ nhạy, độ đặc hiệu
của công nghệ RPA (4)

Tối ưu thành phần phản ứng
khuếch đại acid nucleic (3)

Sản xuất thử nghiệm 500 test
chẩn đoán O. tsutsugamushi (5)

Đánh giá độ nhạy, độ đặc hiệu
của bộ kit (6)

Đánh giá độ ổn định bộ kit chẩn
đoán O. tsutsugamushi (8)

Đánh giá độ chính xác và độ
lặp lại của bộ kit (7)

Xây dựng tiêu chuẩn cơ sở cho
bộ kit (9)

Xây dựng quy trình XN chẩn
đoán O. tsutsugamushi (10)

Hình 2.2. Quy trình chế tạo kit phát hiện O. tsutsugamushi
Bước 1: Thiết lập chứng dương:
Căn cứ trên báo cáo về tính đa hình các gene của Orientia tsutsugamushi lưu
hành trên thế giới và Việt Nam, nhóm nghiên cứu lựa chọn gene 47 kDa làm khuôn
để thiết kế bộ công cụ primer/probe dùng cho các kỹ thuật trong đề tài. Các bộ
primer/probe đều được đánh giá khả năng đặc hiệu và các thông số cần thiết bằng
công cụ BLAST. Plasmid tái tổ hợp gồm trình tự gen đích 47 kDa đã được khuếch đại
bằng PCR và vector tách dòng pJET1.2/blunt sau tách chiết được đánh giá trên hệ
thống Nanodrop cho thấy độ tinh sạch cao với tỉ lệ A260/280 là 1,84 nằm trong khoảng
giá trị cho phép (1,8 - 2,0) với nồng độ khá cao (20,1 ng/µl). Sản phẩm sau khi cắt
bằng enzyme giới hạn BamHI được giải trình tự.
Bảng 3.15. Trình tự primer và probe khuếch đại acid nucleic bằng PCR và RPA
Công nghệ Primer
DNA sequence (5’-3’)
Realtime Forward
AACTGATTTTATTCAAACTAATGCTGCT
PCR
Reverse
TATGCCTGAGTAAGATACRTGAATRGAATT
5′FAMTGGGTAGCTTTGGTGGACCGATGTTTAATCTProbe
BHQ1-3′
RPA
Forward
TAAAGTTGCATGATGGTTCAGAACTGATAGCA
Reverse
TATTGCAATAACCTGATCTCCTACTCTAGA
5’dATTAAAAATTAATTCTTCAGCAGCATTATCTTAProbe
(FAM-dT)-GC-(THF)-AC-(BHQ1-dT)TTTGGCGATTCA-3’ blocker
Bảng 3.16. Trình tự primer/probe cho phản ứng khuếch đại chứng nội
Primer/Primer
DNA sequence (5’-3’)
Realtime Forward
5′-GTG CAC CTG ACT CCT GAG GAG A-3
PCR
Reverse
5′-CCT TGA TAC CAA CCT GCC CAG-3
5′-(FAM)AAG GTG AAC GTG GAT GAA GTT GGT GG
Probe
(BHQ1)-3′


14
Bước 2: Tối ưu điều kiện phản ứng khuếch đại acid nucleic của O.
tsutsugamushi bằng công nghệ Realtime PCR và RPA để xác định điều kiện phản ứng
phù hợp nhất.
Bảng 3.17. Bảng điều kiện tối ưu của phản ứng Realtime PCR
TT
Các bước
Nhiệt độ Thời gian
Đơn vị
1
Biến tính ban đầu
95
15
Phút
Khuếch đại
Biến tính
94
15
Giây
2
(Số chu kỳ: 45)
Gắn mồi
63
30
Giây
Kéo dài
72
30
Giây
3
Lưu mẫu
25

Bảng 3.18. Bảng điều kiện tối ưu của phản ứng RPA
TT
1
2

Điều kiện phản ứng RPA
Giá trị tối ưu
Đơn vị
Nhiệt độ phản ứng
37
ºC
Thời gian thu nhận tín hiệu huỳnh quang
30
Giây
Bước 3: Tối ưu thành phần phản ứng khuếch đại acid nucleic O.
tsutsugamushi.
Nồng độ thành phần mồi, probe và MgOAc lần lượt là 0,54µM, 0,1µM và
18mM là tối ưu đảm bảo hiệu suất phản ứng RPA là cao nhất và phù hợp với điều
kiện thương mại hóa, phục vụ chế tạo kit phát hiện Orientia tsutsugamushi.
Bước 4: Xác định độ nhạy, độ đặc hiệu của công nghệ RPA
Quy trình phát hiện O. tsutsugamushi bằng công nghệ RPA tối ưu có độ đặc
hiệu cao (chứng âm không cho tín hiệu khuếch đại) và có khả năng phát hiện được
mẫu DNA của O. tsutsugamushi ở nồng độ 10 copy/phản ứng. Cho kết quả phát hiện
DNA O. tsutsugamushi trong thời gian ngắn (<20 phút), nhanh hơn rất nhiều so với
các công nghệ khác như PCR, Realtime PCR.
Bước 5: Sản xuất thử nghiệm 500 test chẩn đoán O. tsutsugamushi
Nhóm nghiên cứu lựa chọn công nghệ RPA khuếch đại acid nucleic có
khả năng chẩn đoán O. tsutsugamushi với độ nhạy và độ đặc hiệu cao nhất để hoàn
thiện quy trình và chế tạo 500 test.
Từ kết quả đánh giá độ nhạy và độ đặc hiệu của các công nghệ khuếch đại
ADN Orientia tsutsugamushi cho thấy công nghệ RPA khuếch đại đẳng nhiệt độ nhạy,
độ đặc hiệu cũng như ưu điểm trong ứng dụng lâm sàng. Do đó, đề tài đã lựa chọn
công nghệ RPA khuếch đại acid nucleic Orientia tsutsugamushi để sản xuất thử
nghiệm bộ kit chẩn đoán Orientia tsutsugamushi.


15

Hình 3.9. Hình ảnh bộ sinh phẩm chẩn đoán Orientia tsutsugamushi
Bảng 3.2. Thành phần của bộ kit
TT
1
2
3
4
5

Thành phần
Ký hiệu
Thể tích
Reaction Buffer
A1, A2
780 µl
dNTPs
B1, B2
100 µl
Probe E-mix
C1, C2
120 µl
Nuclease-freewwater
D1, D2
200 µl
Orientia tsutsugamushi
I1, I2
100 µl
oligo-mix
6
Exo
E1, E2
22 µl
7
Core Reaction Mix
F1, F2
60 µl
8
Positive Control
G1, G2
100 µl
9
MgOAc
H1, H2
100 µl
Bước 6: Đánh giá độ nhạy, độ đặc hiệu của bộ kit.
- Độ nhạy, độ đặc hiệu:
Nhóm nghiên cứu tiến hành phân tích 37 mẫu bệnh phẩm dương tính với O.
tsutsugamushi (nhóm bệnh) và 100 mẫu bệnh phẩm âm tính với O. tsutsugamushi người khỏe mạnh (nhóm chứng) sử dụng bộ kit phát hiện O. tsutsugamushi đã được
nhóm nghiên cứu xây dựng. Kết quả phát hiện thấy O. tsutsugamushi trong 36 mẫu
bệnh phẩm dương tính với O. tsutsugamushi tương đương với độ nhạy của bộ kit phát
hiện O. tsutsugamushi là 97,3% (36/37). Trên nhóm chứng khỏe mạnh, kết quả không
phát hiện thấy O. tsutsugamushi trong 99 mẫu bệnh phẩm âm tính với O.
tsutsugamushi tương ứng với độ đặc hiệu của bộ kit phát hiện O. tsutsugamushi là
99% (99/100).
Bước 7: Đánh giá độ chính xác và độ lặp lại của bộ kit
- Độ chính xác: Thử nghiệm phát hiện O. tsutsugamushi với kit phát hiện O.
tsutsugamushi lặp lại 3 lần trên 10 mẫu bệnh phẩm giả định. Trong số 10 bệnh phẩm
giả định thử nghiệm có 2 mẫu bệnh phẩm âm tính với O. tsutsugamushi và 8 mẫu
bệnh phẩm có chứa các hàm lượng O. tsutsugamushi khác nhau. Kết quả cho thấy bộ
kit phát hiện O. tsutsugamushi phù hợp 100% với kết quả đã biết của 10 mẫu bệnh
phẩm giả định. Như vậy, bộ kit phát hiện O. tsutsugamushi có độ chính xác cao.
- Độ lặp lại: Sử dụng kit phát hiện O. tsutsugamushi để phát hiện O.


16
tsutsugamushi trên 10 mẫu bệnh phẩm giả định. Trong đó, có 2 mẫu bệnh phẩm âm
tính với O. tsutsugamushi và 8 mẫu bệnh phẩm có chứa các hàm lượng O.
tsutsugamushi khác nhau từ 150 bản sao/phản ứng đến 145.000 bản sao/phản ứng. Kết
quả cho thấy các mẫu có nồng độ ≥500 bản sao/phản ứng, độ lặp lại của bộ kit rất tốt
thể hiện qua kết quả giống nhau trong 3 lần lặp lại được thực hiện bởi 1 người và so
sánh giữa 2 người thực hiện. Các mẫu có nồng độ <500 bản sao/phản ứng có độ lặp
lại thấp hơn. Như vậy, bộ kit phát hiện O. tsutsugamushi có độ lặp lại tốt.
Bước 8: Đánh giá độ ổn định của bộ kit
- Tính ổn định của bộ kit phát hiện O. tsutsugamushi được đánh giá dựa trên
kết quả dương/âm tính và việc so sánh thời gian thu nhận được tín hiệu khuếch đại
giữa các phản ứng sử dụng lô sản phẩm bảo quản và lô sản phẩm mới trên cùng một
mẫu bệnh phẩm.
Bảng 3.243. Kết quả đánh giá độ ổn định của bộ kit dựa trên kết quả phát hiện
Orientia tsutsugamushi trong mẫu bệnh phẩm
Thời gian bảo quản
Kết quả XN của lô sản
Kết quả XN của lô
phẩm bảo quản
sản phẩm mới
7 ngày bảo quản
+
+
14 ngày bảo quản
+
+
30 ngày bảo quản
+
+
60 ngày bảo quản
+
+
90 ngày bảo quản
+
+
Kết quả cho thấy với cùng một mẫu bệnh phẩm được phân tích trên lô sản
phẩm đã bảo quản sau thời gian 7, 14, 30, 60 và 90 ngày cùng với lô sản phẩm mới,
kết quả phát hiện O. tsutsugamushi trên mẫu bệnh phẩm sử dụng lô sản phẩm đã qua
bảo quản trùng hợp 100% so với lô sản phẩm chuẩn bị mới. Thời gian thu nhận được
tín hiệu khuếch đại sử dụng lô sản phẩm đã qua bảo quản muộn hơn khi sử dụng lô
sản phẩm mới chuẩn bị với thời gian chênh lệch trung bình là 36,48 giây. Như vậy bộ
kit phát hiện O. tsutsugamushi có tính ổn định cho đến ít nhất 90 ngày trong điều kiện
bảo quản phù hợp (-200C).
Bảng 3.4. Kết quả đánh giá độ ổn định bộ kit dựa trên thời gian thu nhận được tín
hiệu khuếch đại
Thời gian bảo quản
Kết quả thử nghiệm lô
Kết quả thử nghiệm
sản phẩm bảo quản
lô sản phẩm mới
7 ngày bảo quản
6,72 phút
6,59 phút
14 ngày bảo quản
6,49 phút
6,17 phút
30 ngày bảo quản
7,44 phút
6,59 phút
60 ngày bảo quản
7,45 phút
6,72 phút
90 ngày bảo quản
7,78 phút
6,77 phút
Bước 9: Xây dựng tiêu chuẩn cơ sở cho bộ kit khuếch đại acid nucleic chẩn
đoán O. tsutsugamushi.
Nhóm nghiên cứu đã xây dựng thành công tiêu chuẩn cơ sở cho bộ kit khuếch
đại acid nucleic chẩn đoán Orientia tsutsugamushi. Nội dung tiêu chuẩn cơ sở cơ bản
gồm các nội dung:
- Mục đích của bộ kit.


17
- Phần nội dung: nguyên lý bộ kit, đích phát hiện, thành phần bộ kit, vật liệu
hóa chất và thiết bị cung cấp bởi người sử dụng, cách tiến hành.
- Đóng gói, ghi nhãn: mô tả sản phẩm và đóng gói.
Bước 10: Xây dựng quy trình xét nghiệm chẩn đoán O. tsutsugamushi bằng
bộ kit khuếch đại đẳng nhiệt RPA.
Quy trình thực hiện xét nghiệm như sau:
Mẫu bệnh phẩm

Tách chiết DNA
RPA khuếch đại acid nucleic đẳng
nhiệt
Đọc kết quả
-

Thực hiện phản ứng RPA khuếch đại acid nucleic:
+ Rã đông hoàn toàn các thành phần phản ứng và mẫu ADN đã tách chiết (nếu
đông) và giữ chúng ở trên đá.
+ Trộn đều và ly tâm nhanh các thành phần phản ứng để được các hỗn hợp
đồng nhất, sau đó giữ chúng ở trên đá để có hiệu quả xét nghiệm cao nhất.
+ Chuẩn bị hỗn hợp phản ứng.
Bảng 3.29. Thành phần hỗn hợp phản ứng
STT
1
2
3
4
5

Thành phần

Nồng độ gốc

Reaction Buffer
2X
dNTPs
25 mM
Nuclease-freewater
Probe E-mix
10 X
Oligo-mix
Core Reaction Mix
20 X
6
Exo
50 X
Tổng thể tích dung dịch đệm thực hiện phản ứng
8
MgOAc
280 mM
9
Mẫu ADN
Tổng thể tích dung dịch thực hiện phản ứng

Thể tích cho 1
phản ứng (µl)
10
1,44
0,52
2
1,64
1
0,4
17
1
2
20


18
Bảng 3.30. Chu trình nhiệt
Nhiệt độ
Thời gian
Ghi chú
37°C
20 phút
Khuếch đại (20s thu tín hiệu 1 lần)
4°C
Không xác định Lưu mẫu trên máy
+ Chuyển các ống phản ứng vào máy đẳng nhiệt và bắt đầu phản ứng theo điều
kiện phản ứng đã cài đặt.
- Đọc kết quả:
+ Kết quả phát hiện Orientia tsutsugamushi sử dụng bộ kit đẳng nhiệt RPA
được xác định dựa vào tín hiệu khuếch đại thu được từ hệ thống thu nhận tín
hiệu huỳnh quang.
+ Kiểm tra các mẫu đối chứng dương và đối chứng âm để đảm bảo kết quả xét
nghiệm không phải là kết quả âm tính giả hoặc dương tính giả.
Mẫu đối chứng dương phải cho kết quả dương tính và có thời gian thu
nhận được tín hiệu khuếch đại trùng khớp với thời gian thu nhận được tín
hiệu khuếch đại của mẫu đã được chuẩn độ trước đó (mẫu chứng dương
cung cấp kèm bộ kit có thời gian thu nhận được tín hiệu khuếch đại là 8 10 phút).
Mẫu chứng âm phải cho kết quả âm tính.
+ Nếu hệ thống mẫu đối chứng dương và đối chứng âm không đúng thì phải
thực hiện lại xét nghiệm.
Chương 4.
BÀN LUẬN
4.1. Đặc điểm nhiễm Orientia tsutsugamushi, ấu trùng mò và phân bố bệnh sốt
mò tại khu vực Tây Bắc
Việt Nam là nước lưu hành bệnh sốt mò, bệnh đã được phát hiện từ đầu thế kỷ
XX. Sau năm 1990, bệnh sốt mò có xu hướng gia tăng số mắc và mở rộng diện phân
bố trong những năm gần đây [34].
Tỷ lệ người có kháng thể kháng O. tsutsugamushi có ở cả 4 điểm nghiên cứu với
tỷ lệ khác nhau, tỷ lệ nhiễm chung của 4 điểm là 12,7%. Điểm nghiên cứu có tỷ lệ
người có kháng thể kháng O. tsutsugamushi cao nhất là Hòa Bình 16,72%, tiếp đến là
Điện Biên 14,42%, Sơn La 9,05% và Lai Châu 8,67%. Kết quả này phù hợp với tỷ lệ
khảo sát chung tỷ lệ người có kháng thể kháng Orientia tsutsugamushi của khu vực
châu Á [44]. Tuy nhiên, tỷ lệ người có kháng thể kháng O. tsutsugamushi ở các điểm
nghiên cứu đều thấp hơn kết quả của tác giả Đoàn Trọng Tuyên và cs. khi điều tra
huyết thanh học phát hiện kháng thể kháng O. tsutsugamushi trong cộng đồng dân cư
tại Khánh Hòa (21,04%) [35]. Tỷ lệ nhiễm O. tsutsugamushi ở Hòa Bình và Điện Biên
cao hơn ở Gia Lai (10,58%); tất cả 4 tỉnh nghiên cứu đều cao hơn Kon Tum (5,2%)
[34].
Bệnh sốt mò thường gặp ở những vùng rừng núi, cây cối rậm rạp, có nhiều cỏ
dại, đặc biệt là những khu vực như bờ suối, hang hốc, rừng mới phá hoặc mới
trồng…Nghiên cứu của chúng tôi thấy rằng tỷ lệ người có kháng thể kháng O.
tsutsugamushi trong cộng đồng dân cư sống trong khu vực có đặc điểm sinh cảnh là
Savan cao nhất (15,19%), sau đó đến rừng tái sinh (14,03%) và vùng rừng nguyên


19
sinh (6,16%). Kết quả này tương tự kết quả nghiên cứu tại Tây Nguyên với tỷ lệ nhóm
người người mang kháng thể kháng O. tsutsugamushi sống trong sinh cảnh Savan
15,16%, rừng tái sinh từ 13,99% và rừng nguyên sinh 5,21% [34].
Kết quả nghiên cứu của chúng tôi cho thấy không có sự khác biệt tỷ lệ nhiễm O.
tsutsugamushi giữa Nam (10,93%) và Nữ (13,54%) và giữa các dân tộc. Tuy nhiên có
sự khác biệt về lứa tuổi nhiễm, tỷ lệ nhiễm lứa tuổi lao động cao hơn các nhóm khác.
Tỷ lệ nhiễm ở nhóm làm nghề nông nghiệp, lâm nghiệp cao hơn các nhóm còn lại.
- Một số đặc điểm phân bố của bệnh sốt mò
+ Phân bố của bệnh nhân sốt mò theo địa phương
Cả 4 tỉnh nghiên cứu đều có bệnh nhân sốt mò được phát hiện và điều trị tại các
bệnh viện đa khoa tỉnh. Tỉnh có số bệnh nhân sốt mò nhiều nhất là Điện Biên (78 bệnh
nhân chiếm 33,91% số ca bệnh sốt mò của 4 tỉnh), tiếp đến là Hòa Bình (69 bệnh nhân
chiếm 30,00%), Sơn La (48 bệnh nhân chiếm 20,87%), thấp nhất là Lai Châu (35 bệnh
nhân chiếm 15,22%). Nghiên cứu của chúng tôi bổ sung thêm căn cứ cho thấy, bệnh
sốt mò có khả năng lưu hành ở tất cả các địa phương miền Bắc nước ta. Một trong
những cơ sở khẳng định cho nhận định này là phân bố rộng rãi của mò
Leptotrombidium ở tất cả các vùng miền và các địa hình của nước ta, theo kết quả
khảo sát của Nguyễn Văn Châu [6], [12], [13]. Nghiên cứu của chúng tôi và các nghiên
cứu tương tự khác là tiền đề cho các nghiên cứu sâu và rộng hơn về dịch tễ học của
bệnh sốt mò ở nước ta.
Các bệnh nhân trong nghiên cứu của chúng tôi được thu thập tại các khoa truyền
nhiễm của 4 bệnh viện đa khoa tỉnh. Vì vậy, hầu hết những bệnh nhân này là những
bệnh nhân nặng hoặc chưa rõ chẩn đoán từ các tuyến dưới chuyển lên. Số bệnh nhân
sốt mò được phát hiện và điều trị tại các bệnh viện tuyến tỉnh có thể chỉ là số ít so với
số bệnh nhân sốt mò thực tế, vì không phải tất cả những bệnh nhân sốt mò ở các tuyến
dưới đều được chuyển đến bệnh viện tỉnh. Gánh nặng bệnh tật thực sự của bệnh sốt
mò tại các địa phương có thể còn lớn hơn.
+ Đặc điểm vật chủ và vector truyền bệnh sốt mò
Kết quả xét nghiệm huyết thanh chuột ở cả bốn điểm đều phát hiện có kháng thể
kháng O. tsutsugamushi. Tại Hòa Bình các cá thể loài chuột có kháng thể gồm: chuột
nhắt (13,16%), chuột rừng (36,56%), chuột đất bé (20,97%). Tỷ lệ có kháng thể kháng
O. tsutsugamushi chung là 21,82%. Tại Sơn La các cá thể loài chuột có kháng thể
kháng Rickettsia gồm: chuột nhắt (5,23%), chuột mốc (68,38%). Đáng chú ý loài
chuột mốc sống gần nhà và trong nhà, gần người có tỷ lệ kháng thể kháng cao tại Sơn
La. Tỷ lệ có kháng thể kháng O. tsutsugamushi chung là 42,45%. Tại Điện Biên các
cá thể loài chuột có kháng thể gồm: chuột rừng cao nhất (42,16%), tiếp đến là chuột
đất bé (15,99%) và chuột nhắt (7,03%). Tỷ lệ có kháng thể kháng O. tsutsugamushi
chung là 20,78%. Tại Lai Châu các cá thể loài chuột có kháng thể gồm: chuột mốc
(36,36%), chuột rừng (5,88%) và chuột nhắt (5,10%). Tỷ lệ có kháng thể kháng O.
tsutsugamushi chung là 15,77%. Tỷ lệ chuột có kháng thể kháng O. tsutsugamushi tại
các điểm nghiên cứu cao hơn tại Khánh Hòa (14,30% số cá thể chuột đất bé (B. savilei)
[34].
Mật độ chung các loài chuột ở Hòa Bình là 7,68 (trong nhà là 7,60; ở ngoài nhà
là 7,75), tại Sơn La là 11,43 (trong nhà là 7,65 và ngoài nhà là 15,20), tại Điện Biên


20
là 16,60 (trong nhà là 12,05; ở ngoài nhà là 21,15) và tại Lai Châu là 6,98 (trong nhà
là 7,85 và ngoài nhà là 6,10). Mật độ chuột cao nhất ở Điện Biên (16,6) tương đương
với chỉ số chuột tại Bắc Giang (16,0) [11] và Quảng Ninh (15,58) [7], [12]. Mật độ
chuột các điểm nghiên cứu còn lại thấp hơn so với Bắc Giang và Quảng Ninh nhưng
tương dương với mật độ chuột chung ở Khánh Hòa (6.67 con/100 bẫy/đêm), Gia Lai
(10,0) [34] .
4.2. Chế tạo bộ sinh phẩm phát hiện O. tsutsugamushi quy mô phòng thí nghiệm
- Điều kiện phản ứng của bộ kit khuếch đại đẳng nhiệt RPA phát hiện O.
tsutsugamushi quy mô phòng thí nghiệm
Kỹ thuật khuếch đại đẳng nhiệt RPA sử dụng quy trình có thể hoạt động tối
ưu ở nhiệt độ từ 22 - 45oC và không đòi hỏi sự kiểm soát nhiệt độ một cách chặt chẽ
[83, [86]; Hầu hết các báo cáo đã công bố đều tối ưu nhiệt độ phản ứng trong khoảng
từ 37 - 42oC. So với các kỹ thuật khuếch đại đẳng nhiệt khác như NASBA, SDA hay
LAMP thì điều kiện nhiệt độ của RPA khá dễ dàng thiết lập và đảm bảo [101]. Trên
cơ sở khuyến cáo của nhà sản xuất, enzyme tái tổ hợp sử dụng trong nghiên cứu này
có nhiệt độ phản ứng trong khoảng 37 - 42oC. Để thiết lập được nhiệt độ đảm bảo đạt
hiệu suất khuếch đại cao nhất, dải nhiệt độ phản ứng là 37oC; 38oC; 39oC; 40oC và
41oC đã được tiến hành thử nghiệm.
Kết quả thử nghiệm ở các nhiệt độ khác nhau với cùng một nồng độ mẫu
chứng dương cho thấy, thời gian thu nhận được tín hiệu khuếch đại sớm nhất ở nhiệt
độ 37°C (6 phút 26 giây). Do hạn chế về thời gian, nghiên cứu này mới chỉ sử dụng
thiết bị Genie II (là một thiết bị khuếch đại đẳng nhiệt chuyên dụng, rất nhỏ gọn) để
thực hiện phản ứng RPA, chưa tiến hành các thử nghiệm trên các thiết bị giữ nhiệt
hoặc ủ ấm thông thường. Nhưng với các kết quả nghiên cứu trên cũng cho thấy, kỹ
thuật RPA hoàn toàn có thể được ứng dụng trên các thiết bị thông thường như tủ giữ
nhiệt, bể ổn nhiệt hoặc các block giữ nhiệt. Trên thế giới đã có những công bố thiết
lập phản ứng RPA trên các thiết bị tương tự như trên [86].
- Thời gian của phản ứng RPA
Thời gian phản ứng khuếch đại là thời gian cần thiết để mẫu ADN trong hỗn
hợp phản ứng được khuếch đại đến mức có thể phát hiện được. Thời gian này phụ
thuộc vào số lượng bản sao ADN tại thời điểm phản ứng khuếch đại bắt đầu. Đối với
kỹ thuật RPA, thời gian cần thiết khoảng 20-30 phút, thậm chí có thể sớm hơn (khoảng
3-4 phút) [142]. Thời gian phản ứng kéo dài dường như không có lợi cho loại phản
ứng RPA trong dung dịch, do các enzyme tái tổ hợp đã sử dụng ATP hoàn toàn trong
khoảng thời gian này. Căn cứ vào mối tương quan giữa nồng độ ADN mẫu chứng
chuẩn và thời gian xuất hiện tín hiệu khuếch đại, thời gian 20 phút cho phản ứng RPA
đã được sử dụng trong nghiên cứu này. Kết quả cho thấy hiệu suất khuếch đại đạt
được tốt nhất ở 37oC trong 20 phút sau đó ủ tại nhiệt độ phòng trong 3-5 phút. Trong
nghiên cứu này, kết quả cho thời gian phản ứng là 20 phút.
Như vậy, thời gian phù hợp cho phản ứng của kỹ thuật khuếch đại đẳng nhiệt
RPA là khoảng 20-30 phút, tốt hơn rất nhiều so với các kỹ thuật chẩn đoán đang sử
dụng nhằm phát hiện căn nguyên bệnh sốt mò như ELISA, IFA, PCR hay Realtime
PCR (khoảng 3-6 tiếng) hoặc các kỹ thuật kinh điển trong lâm sàng như nuôi cấy (vài
ngày, thậm chí lên đến 2 tháng) hoặc phản ứng Weil - Felix (thời gian thực hiện dài,


21
độ đặc hiệu thấp).
- Thành phần phản ứng của bộ kit khuếch đại đẳng nhiệt RPA phát hiện
Orientia tsutsugamushi quy mô phòng thí nghiệm
Thành phần của phản ứng khuếch đại gen gồm có enzyme
polymerase, dNTP, KCl, MgCl2… Trong đó dung dịch MgCl2 đóng một vai trò rất
quan trọng quyết định đến chất lượng của phản ứng. Nồng độ ion Mg2+ trong hỗn hợp
phản ứng có thể ảnh hưởng tới độ đặc hiệu và hiệu quả của phản ứng bởi vậy nó được
xác định là thành phần quan trọng nhất. Hầu hết các enzyme polymerase đều cần các
ion hóa trị 2 cho hoạt động của chúng. dNTP và mồi đều gắn với Mg2+ do đó cần điều
chỉnh nồng độ của MgCL2 lớn hơn tổng nồng độ mol của hai thành phần trên. Các ion
âm và EDTA có trong hệ đệm chứa khuôn ADN có thể bắt giữ Mg2+ do đó cần giảm
thiểu số lượng của chúng. Nồng độ MgCl2 cao dẫn tới khả năng hoạt động sao chép
của taq polymerase tăng lên, nhưng sự sao chép chính xác bị giảm xuống. Do đó giảm
nồng độ MgCl2 sẽ tăng sự sao chép chính xác của enzyme. Nồng độ ion Mg2+ sẽ phụ
thuộc vào khuôn và mồi do đó cần phải được chuẩn hóa khi thực hiện PCR. Nồng độ
MgCl2 chuẩn dung dịch cho PCR là 1,5 mM.
Thành phần phản ứng RPA, cũng giống như các kỹ thuật khuếch đại gen
khác, gồm có các ADN hay ARN template, bộ primer/probe, các enzyme tái tổ hợp
và các chất phụ gia tạo hệ đệm thích hợp cho phản ứng diễn ra. Trong quá trình thiết
lập các thành phần phản ứng, yếu tố nồng độ primer/probe và MgOAc được tiến hành
tối ưu cho kết quả như sau: Primer 0,54 µM; Probe 0,1 µM; MgOAc 18 mM.
Ion Mg2+ có vai trò rất quan trọng không chỉ trong liên quan đến độ đặc hiệu
và khả năng khuếch đại của phản ứng, mà còn đóng vai trò kích hoạt các enzyme tái
tổ hợp tham gia kéo dài chuỗi trong quá trình tổng hợp ADN. Với điều kiện nhiệt độ
37oC và không đòi hỏi một sự kiểm soát chặt chẽ về độ dao động về nhiệt, phản ứng
RPA thậm chí có thể hoạt động ở trong điều kiện nhiệt độ môi trường ở những khu
vực khí hậu ấm áp (khoảng 30oC).
Sự có mặt của các chất ức chế: Kỹ thuật RPA đã được chứng minh có thể
thực hiện với mẫu đầu vào là huyết thanh cũng như các mẫu đầu vào có chứa các chất
ức chế phản ứng PCR thông thường như haemoglobin, ethanol hay heparin [83]. Để
đánh giá sơ bộ về vấn đề này, tác giả đã thực hiện thử nghiệm thực hiện phản ứng
RPA với các mẫu huyết thanh của bệnh nhân đã được khẳng định dương tính với
Orientia tsutsugamushi, mẫu huyết thanh người khỏe mạnh được thêm một lượng
ADN của Orientia tsutsugamushi, cùng với các mẫu chứng âm và chứng dương là
plasmid chứa đoạn gen của Orientia tsutsugamushi đã được tạo ra từ các thí nghiệm
trước.
4.2.2. Các thông số kỹ thuật chính của bộ kit khuếch đại đẳng nhiệt RPA phát
hiện O. tsutsugamushi quy mô phòng thí nghiệm
- Ngưỡng phát hiện của bộ kit khuếch đại đẳng nhiệt RPA
Kết quả đánh giá ngưỡng phát hiện của quy trình RPA tối ưu trên bộ panel
chuẩn chứa ADN của Orientia tsutsugamushi ở dạng plasmid của nghiên cứu này đạt
được là 10 copies/phản ứng. Đây là ngưỡng phát hiện rất tốt, có thể sử dụng trong đối
với các mẫu bệnh phẩm là máu của bệnh nhân sốt mò trên lâm sàng.
Tuy nhiên, bộ kit khuếch đại đẳng nhiệt RPA do nhóm thiết lập mới chỉ được


22
đánh giá ngưỡng phát hiện cũng như độ nhạy trên các panel chứng dương chứa
plasmid gen đích 47 kDa của Orientia tsutsugamushi. Khi tiến hành đánh giá độ nhạy
của bộ kit trên 37 mẫu bệnh phẩm dương tính với Orientia tsutsugamushi, đã xác định
được độ nhạy kỹ thuật của bộ kit đạt 97,3%. Các thử nghiệm trên mẫu máu của bệnh
nhân đã được chẩn đoán xác định bệnh sốt mò trên lâm sàng bằng các phương pháp
khác với số lượng mẫu lớn hơn và tại các thời điểm lấy mẫu khác nhau cần phải tiếp
tục tiến hành. Việc này không chỉ có ý nghĩa trong việc đánh giá ngưỡng phát hiện
hay độ nhạy thực sự của bộ kit, mà còn đánh giá được thời điểm thích hợp nhất trên
lâm sàng để thu thập mẫu bệnh phẩm cũng như các loại mẫu bệnh phẩm khác nhau
cần thu thập.
- Độ đặc hiệu của bộ kit khuếch đại đẳng nhiệt RPA
Kết quả về đánh giá độ đặc hiệu kỹ thuật của bộ kit đều đạt 100% trên bộ
panel các mẫu chứng âm và trên panel các chủng vi sinh vật có thể gây triệu chứng
tương tự Orientia tsutsugamushi. Đánh giá độ đặc hiệu trên 99 mẫu bệnh phẩm âm
tính với Orientia tsutsugamushi cho thấy bộ kit đạt 99%. Độ đặc hiệu của bộ kit do
nhóm thiết lập đạt được rất tốt so với các quy trình RPA phát hiện Orientia
tsutsugamushi trên thế giới.
- Đánh giá về ngưỡng phát hiện và độ đặc hiệu của phản ứng RPA so với công
nghệ realtime PCR phát hiện Orientia tsutsugamushi
Các thông số của quy trình khuếch đại acid nucleic đẳng nhiệt RPA cũng đã
được so sánh với bộ sinh phẩm Orientia tsutsugamushi Membrane Protease Gene
Genesig Standard Kit của hãng Primerdesign, đây là bộ kit thương mại với nguyên lý
kỹ thuật realtime PCR có ngưỡng phát hiện và độ đặc hiệu cao. Kết quả đánh giá so
sánh độ nhạy của phản ứng RPA phát hiện Orientia tsutsugamushi với bộ kit Genesig
sử dụng công nghệ realtime PCR cho thấy ngưỡng phát hiện của công nghệ RPA là
10 copies/phản ứng và của công nghệ realtime PCR là 100 copies/phản ứng. Độ đặc
hiệu kỹ thuật của 2 công nghệ RPA và realtime PCR lần lượt là 99% và 100%.
Như vậy, quy trình phản ứng RPA phát hiện Orientia tsutsugamushi được
thiết lập trong nghiên cứu này có độ đặc hiệu kỹ thuật tương đương với bộ kit thương
mại sử dụng công nghệ realtime PCR. Về ngưỡng phát hiện của phản ứng khuếch đại,
quy trình RPA có ngưỡng phát hiện tốt hơn nhiều so với realtime PCR (10 copies/phản
ứng so với 100 copies/phản ứng).
Mặc dù quy trình RPA được tối ưu trong nghiên cứu này mới ở mức phát
hiện định tính mà chưa phải là định lượng, tuy nhiên với ngưỡng phát hiện đạt được
rất tốt gợi ý rằng có thể sử dụng quy trình này ở các điều kiện thực tế mà không cần
trải qua các công đoạn làm giàu mẫu bệnh phẩm nhằm tăng độ nhạy như các kỹ thuật
khuếch đại gen dựa trên phản ứng luân nhiệt đang sử dụng.
4.2.3. Khả năng ứng dụng của bộ kit khuếch đại đẳng nhiệt RPA phát hiện O.
tsutsugamushi
Các kết quả của nghiên cứu này cho thấy kỹ thuật RPA với ngưỡng phát hiện,
độ nhạy và độ đặc hiệu tương đương với công nghệ realtime PCR đã xây dựng và phát
triển thành công để phát hiện Orientia tsutsugamushi. Với kỹ thuật RPA, một khối gia
nhiệt có khả năng duy trì nhiệt độ 37 - 39°C trong 30 phút là đủ để thực hiện phản
ứng. Hỗn hợp phản ứng được tạo ra và cung cấp bởi TwistDx, người dùng chỉ cần bổ


23
sung nước, mẫu, mồi và đầu dò, phản ứng sẽ được bắt đầu khi trộn đều các thành phần,
do đó giảm thiểu khả năng bị ô nhiễm thường gặp ở các phương pháp khuếch đại axit
nucleic khác. Phương pháp này cung cấp nhiều tùy chọn phù hợp với những điều kiện
môi trường phòng thí nghiệm khác nhau, do đó, có thể áp dụng trong phòng thí nghiệm
được trang bị hiện đại, phòng thí nghiệm di động hoặc khu vực có điều kiện hạn chế
về trang thiết bị.
Một trong những yếu tố giúp cải thiện ngưỡng phát của phản ứng RPA chính
là điều kiện và thành phần phản ứng. Thực tế cho thấy ngưỡng phát hiện của công
nghệ RPA là 10 copy/phản ứng, với điều kiện nhiệt độ tối ưu tối ưu là 37ºC, nồng độ
mồi, probe và MgOAc lần lượt là 0,54 µM, 0,1µM và 18mM. Các điều kiện này được
tối ưu đảm bảo hiệu suất phản ứng RPA là cao nhất và phù hợp với điều kiện thương
mại hóa, phục vụ chế tạo kit phát hiện Orientia tsutsugamushi
Công nghệ RPA đã thiết lập có độ đặc hiệu khi đánh giá trên mẫu bệnh phẩm
âm tính và trên các chủng vi khuẩn có thể gây ra một số triệu chứng gần tương tự với
Orientia tsutsugamushi lần lượt là 99% và 100%. Độ nhạy khi đánh giá trên các mẫu
âm tính giả định là 97,3 % (36/37). Như vậy, công nghệ RPA đã xây dựng không
những có ngưỡng phát hiện tương đương mà còn có độ nhạy, độ đặc hiệu tương đương
với realtime PCR cho thấy khả năng ứng dụng trong lâm sàng phát hiện Orientia
tsutsugamushi giúp chẩn đoán sớm bệnh sốt mò. Một điểm nổi bật của nghiên cứu là
đã đánh giá quy trình RPA phát hiện Orientia tsutsugamushi trên các tiêu chí cần thiết
để phát triển một bộ sinh phẩm thương mại cho thấy độ nhạy, độ đặc hiệu, độ lặp lại
cao, độ chính xác như mong đợi (100%) và độ ổn định của sinh phẩm đạt trên 3 tháng
sử dụng trong điều kiện bảo quản được đề xuất.
KẾT LUẬN
1.

Một số đặc điểm nhiễm Orientia tsutsugamushi, ấu trùng mò và đặc điểm
phân bố bệnh sốt mò tại khu vực Tây Bắc
- Tỷ lệ người có kháng thể kháng Orientia tsutsugamushi chung tại khu vực Tây
Bắc là 12,17% (185/1.520), trong đó ở nữ 13,54% (98/724) và nam là 10,93%
(87/796); Tỷ lệ cao hơn ở nhóm tuổi 41 - 50 (23,01%) và nhóm người làm ruộng
(24,68%). Tỷ lệ người có kháng thể kháng Orientia tsutsugamushi tại Hòa Bình
16,72% (55/329), Sơn La 9,05% (39/431), Điện Biên 14,42% (63/437) và Lai Châu
8,67% (28/323).
- Trong 2 năm (từ 01/01/2016 - 31/12/2017), cả 4 tỉnh nghiên cứu đều có bệnh
nhân sốt mò đến khám và điều trị tại bệnh viện tỉnh (Điện Biên 78 trường hợp (chiếm
33,91%), Hòa Bình 69 trường hợp (30,0%), Sơn La 48 trường hợp (20,87%), Lai Châu
35 trường hợp (15,22%). Bệnh gặp nhiều ở lứa tuổi 41 - 50 tuổi (23,91%).
Bệnh sốt mò xuất hiện vào tất cả các tháng trong năm, cao điểm là từ tháng 5 đến
tháng 10 (năm 2016) và từ tháng 5 đến tháng 9 (năm 2017). Bệnh giảm thấp nhất vào
tháng một và tháng hai hàng năm.
- Đặc điểm vật chủ và vector truyền bệnh sốt mò ở khu vực Tây Bắc
Tại Hòa Bình, tỷ lệ chuột có kháng thể kháng Orientia tsutsugamushi là
21,82% (n=307). Tỷ lệ chuột nhiễm mò là 43,65%. Thu thập được 3 loài chuột nhắt,
chuột rừng và chuột đất bé. Mật độ 7,68.


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×

×