Tải bản đầy đủ

Nghiên cứu xây dựng quy trình và đánh giá sự có mặt của nấm mốc và vi khuẩn hiếu khí trong không khí môi trường lao động

Luận văn Thạc sĩ sinh học

Vũ Duy Thanh

VIỆN HÀN LÂM KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM
VIỆN SINH THÁI VÀ TÀI NGUYÊN SINH VẬT

---------------------------------------

VŨ DUY THANH

NGHIÊN CỨU XÂY DỰNG QUY TRÌNH VÀ ĐÁNH
GIÁ SỰ CÓ MẶT CỦA NẤM MỐC VÀ VI KHUẨN
HIẾU KHÍ TRONG KHÔNG KHÍ MÔI TRƯỜNG
LAO ĐỘNG

Chuyên ngành: Vi sinh vật học

Hà Nội - 2014

K16


1Viện

Sinh thái và Tài nguyên sinh vật


Luận văn Thạc sĩ sinh học

Vũ Duy Thanh

MỞ ĐẦU
Trong không khí, ngoài bụi là thành phần chính còn có các vi sinh vật như vi
khuẩn, nấm mốc, các thành phần này có liên quan mật thiết với nhau như nồng độ
bụi, bụi hữu cơ càng nhiều thì số lượng vi sinh vật càng nhiều, vi sinh vật trong
không khí gồm rất nhiều loại khác nhau như cầu khuẩn gây bệnh, trực khuẩn lao,
trực khuẩn bạch hầu và các tạp khuẩn khác, quan trắc vi sinh vật trong không khí là
một cách để dự phòng và định hướng những nguy cơ tiểm ẩn gây ra bởi ô nhiễm
sinh học trong không khí. Điều kiện ngoại cảnh và điều kiện thời tiết có ảnh hưởng
rất nhiều tới tình trạng và số lượng vi sinh vật trong không khí, khí hậu Việt Nam
thuộc vùng khí hậu nhiệt đới ấm và ẩm, trong cả nước Việt Nam có những vùng
khác nhau về khí hậu như ở miền Bắc thì thuộc vùng khí hậu nhiệt đới ấm ẩm, vùng
khí hậu khu vực miền Trung thuộc vùng nhiệt đới gió mùa, vùng khí hậu vùng phía
nam thuộc vùng khí hậu nhiệt đới Xavan (có hai mùa rõ rệt là mùa khô và mùa
mưa), chính vì sự đa dạng này mà trong các vùng của Việt Nam có sự phân bố số
lượng các vi sinh vật trong không khí cũng khác nhau rất nhiều. Tùy theo từng mùa
có sự phát triển từng loại vi khuẩn hay vi nấm gây bệnh phát triển nhanh và gây ra
những bệnh dịch hàng loạt. Mùa hè ở khu vực miền Bắc là nắng nóng, kèm theo ẩm
cao tạo ra môi trường thuận lợi cho các vi sinh vật gây bệnh phát triển, tác nhân gây
ra những bệnh như viêm phổi, cảm cúm và nhiều bệnh khác nữa.
Hiện nay khoa học công nghệ sinh học, khoa học y học tiên tiến đã tìm ra
được nguồn gốc và tác nhân gây bệnh trên người, động vật đều do các loài vi sinh
vật gây lên, chúng có mặt ở khắp mọi nơi trên trái đất, trên cơ thể động vật thực vật,
người hay các bộ phận cấp độ nhỏ hơn nữa. Chúng có thể phát tán và lây nhiễm
thông qua đất, nước, môi trường không khí là con đường phát tán rất nhanh và có
thể lây nhiễm bệnh cho một vùng rộng lớn và rất nhanh chóng nếu trong thành phần
không khí có mật độ vi sinh gây dịch bệnh.
Việt Nam là nước công nghiệp hóa, hàng năm với số lượng các công ty nước
ngoài đặt tại Việt Nam, tận dụng nguồn nhân lực rẻ tại đây, mật độ công nhân làm
việc trong các dây chuyền sản xuất của các công ty này số lượng rất lớn, nguy cơ
lây truyền bệnh dịch rất cao, trong khi đó nước ta cũng chưa có nhiều hành lang


pháp lý, điều kiện để phòng ngừa kiểm soát các rủi do đó, việc kiểm soát đo kiểm
môi trường lao động của các công ty này chưa có chuẩn mực cấp quốc gia, chưa có
được các phương pháp có độ chính xác, độ tin cậy cao khi sử dụng quan trắc môi
trường lao động tại Việt Nam, nghiên cứu xây dựng quy trình đánh giá các yếu tố

K16

2Viện

Sinh thái và Tài nguyên sinh vật


Luận văn Thạc sĩ sinh học

Vũ Duy Thanh

gây ô nhiễm là việc rất cần thiết, nhằm xây dựng cơ sở dữ liệu diễn biến môi
trường, nhằm cảnh báo các nguy cơ gây nhiễm bởi các yếu tố sinh học.
Nghiên cứu quy trình kỹ thuật phân tích vi sinh vật trong không khí là cần
thiết, hiện nay chưa có một quy trình kỹ thuật nào là chính thức được chứng minh
về độ chính xác và được phổ biến một cách chính thống trong các phòng thí nghiệm
tại Việt Nam, hay chứng minh tính chính xác của quy trình kỹ thuật một cách bài
bản nhất về quy trình phân tích vi sinh vật trong không khí.
Trên cơ sở lý luận khoa học và ý nghĩa thực tiễn được trình bày ở trên, chúng
tôi đã thực hiện đề tài: “Nghiên cứu xây dựng quy trình và đánh giá sự có mặt của
nấm mốc và vi khuẩn hiếu khí trong không khí môi trường lao động”, với các mục
tiêu và nội dung chính sau đây:
Mục tiêu cơ bản của đề tài luận văn :
- Đánh giá được tổng vi khuẩn hiếu khí và tổng nấm trong môi trường
không khí lao động.
- Có quy trình phân tích tổng vi khuẩn hiếu khí và tổng nấm trong không
khí môi trường lao động.
Nội dung nghiên cứu :
- Khảo sát chọn lựa môi trường nghiên cứu cũng như khảo sát lấy mẫu không
khí.
- Quan trắc môi trường không khí lao động.
- Đánh giá ô nhiễm chất lượng môi trường không khí tại cơ sở sản xuất thực
phẩm.
- Xây dựng quy trình phân tích nấm mốc và vi khuẩn hiếu khí trong không
khí môi trường lao động
Ý nghĩa khoa học và thực tiễn của đề tài :
- Đề tài góp phần bổ sung cơ sở lý luận trong việc nghiên cứu sự có mặt của
nấm và vi khuẩn hiếu khí trong không khí môi trường lao động.
- Đưa ra một quy trình phân tích tổng vi khuẩn hiếu khí và tổng nấm trong
không khí môi trường lao động.

K16

3Viện

Sinh thái và Tài nguyên sinh vật


CHƯƠNG I. TỔNG QUAN TÀI LIỆU
1.1. TÌNH HÌNH NGHIÊN CỨU VI SINH VẬT TRONG KHÔNG KHÍ TRÊN
THẾ GIỚI VÀ VIỆT NAM
1.1.1. Tình hình nghiên cứu vi sinh vật trong không khí trên thế giới
Thế giới đã quan tâm nhiều đến sự tồn tại và phát tán của các vi sinh vật
trong không khí, tuy môi trường không khí không phải là môi trường dinh dưỡng, vi
sinh vật không thể sinh trưởng được, nhưng không vì thế mà môi trường không khí
không ô nhiễm. Sự tồn tại và phân tán của các vi sinh vật trong không khí là một
hiểm họa tiềm tàng gây ra các loại bệnh, có cả những bệnh hiểm nghèo, có thể tạo
đà bùng phát dịch bệnh. Viện Nghiên cứu quốc gia về sức khỏe và an toàn lao động
của Mỹ (NIOSH) cũng đã đưa ra phương pháp lấy mẫu bioaerosol cho vùng không
khí trong nhà (indoor air) từ những năm 1998 (Method NIOSH). Quan trắc vi khuẩn
và nấm mốc trong không khí không chỉ đánh giá chất lượng môi trường không khí
khu vực đó mà còn phát hiện sớm nguồn gốc có nguy cơ nhiễm bệnh, nhằm phòng
chống được sự gây bệnh do vi sinh vật và gây nguy cơ ngộ độc thực phẩm do sự
phát tán vi khuẩn, nấm và nấm mốc trong không khí [28].
1.1.2. Tình hình nghiên cứuvi sinh vật trong không khí ở Việt Nam
Việt Nam hiện nay chưa có nhiều người quan tâm đến sự ảnh hưởng của vi
sinh không khí, chưa nhìn thấy ảnh hưởng như thế nào đến môi trường cộng đồng.
Năm 2003 Từ Hải Bằng ứng dụng kỹ thuật đặt đĩa thạch lấy mẫu không khí đánh
giá chất lượng không khí về mặt sinh học trong phòng thí nghiệm vi sinh kết quả so
sánh hai mùa đông và mùa hè, chỉ tiêu đánh giá trung bình mật độ trong không khí
3

3

2

3

TVKHK là 2,6.10 CFU/m không khí cao hơn mùa hè rất nhiều là 5,13.10 CFU/m
2

3

không khí, tổng số nấm cũng tương tự như vậy lần lượt là 5,2.10 CFU/m vào mùa
2

3

nóng và mùa lạnh là 4,62.10 CFU/m [1]. Năm 2009 Nguyễn Quốc Tuấn có nghiên
cứu đánh giá chất lượng các phòng mổ của 13 bệnh viện quanh thành phố Hồ Chí
Minh, kết quả cho thấytỷ lệ phòng mổ, phòng hồi sức đạt mức C theo tiêu chuẩn EU
GMP 1997 và WHO 2002 là 6,1%; đạt mức D là 21,2%, tỷ lệ đạt theo tiêu chuẩn


3

phòng phẫu thuật của Merck 2009 (10 ÷ 200 CFU/m ) là 21,2%. Số lượng vi sinh
trong không khí của 13 bệnh viện tại Thành phố Hồ Chí Minh phần lớn tập trung
2

2

3

trong khoảng từ 2.10 ÷ 5.10 CFU/m chiếm 70% (23/33 phòng) [9]. Năm 2010
Trịnh Quỳnh Mai đã có nghiên cứu so sánh hai phương pháp lấy mẫu bằng thiết bị
và lấy mẫu đạt đĩa thạch kết quảdùng thiết bị lấy mẫu có độ đồng đều hơn so với
phương pháp đặt đĩa thạch [6]. Năm 2011 có nhiều nghiên cứu khảo sát mức độ
nhiễm nấm môi trường không khí phòng không máy lạnh, các dược liệu đang bán
tại thành phố Hồ Chí Minh, mức ô nhiễm đều vượt qua mức giới hạn cho phép tiêu
chuẩn WHO [36].
1.2. SỰ TỒN TẠI CỦA VI SINH VẬT TRONG KHÔNG KHÍ
Môi trường không khí không phải làm môi trường có thành phần dinh
dưỡng, vi sinh vật không sinh trưởng trong không khí, vi sinh vật chúng bám vào
các hạt bụi lơ lửng bay trong không khí, đã tìm thấy rất nhiều những loại vi sinh vật
khác nhau tồn tại trong không khí. Qua đó nhiều người đã có những quy định chung
về tên gọi là Bioaerosol. Bioaerosol được hiểu là bao gồm các hạt bụi sinh học lơ
lửng trong không khí trong đó có cả vi khuẩn và nấm, các hạt phấn hay bào tử khác.
1.2.1. Vi khuẩn trong không khí
Vi khuẩn không tồn tại độc lập trong môi trường không khí vì vi khuẩn là
sinh vật rất nhỏ nó không thể tự phát tán và di chuyển trong không khí được và nó
thường bám vào các hạt bụi lơ lửng trong không khí hay các dạng hạt khác có thể di
chuyển lơ lửng trong không khí, sự phát tán của vi khuẩn trong không khí là gián
tiếp nhờ các vật chủ khác có thể bay lơ lửng trong không khí, di chuyển từ nơi này
đến nơi khác nhờ sự tác động của gió, bão, sự chuyển động trong không khí đưa đẩy
các hạt bụi trong không khí.
Vi khuẩn không sinh trưởng được trong không khí nhưng hiện nay các nhà
khoa học đã tìm thấy những nguy cơ tiềm ẩn các rủi do có nguồn gốc từ không khí.
Nhưng một số loài vi khuẩn vẫn có thể tồn tại vài giờ đến vài tháng trong môi
trường không khí được, như vi khuẩn lao chẳng hạn nó có thể tồn tại trong môi


trường tự nhiên khoảng 3 ÷ 4 tháng, vì chúng có thể bám vào các hạt bụi lơ lửng
trong không khí.
1.2.1.1. Bacillus trong không khí
Vi khuẩn Bacillus bao gồm những loại vi khuẩn hình que, Gram (+), hiếu khí
thuộc họ Bacillaceae, chúng có mặt ở khắp nơi, cả nhưng nơi có điều kiện khắc
nghiệt nhất. Điều kiện sống gay go nhất chúng tạo ra bảo tử gần như hình cầu để tự
tồn tại ở dạng giống như ngủ đông. Đa số các chủng của vi khuẩn này vô hại, chỉ có
hai loài là được xem là quan trọng đó là B. anthracis và B. cereus thường gây ngộ
độc thực phẩm, B. anthracis gây bệnh than chết người sử dụng làm vũ khí sinh học
tuy nhiên cũng chưa có nghiên cứu nào công bố đã tìm thấy trong không khí, B.
subtilis là chủng xuất hiện nhiều, chúng có khả năng đối kháng với các vi khuẩn gây
bệnh khác như E.coli, trong ruột người chúng là những vi sinh có ích giúp cải thiện
hệ thống tiêu hóa. Ngộ độc thực phẩm gây ra bởi vi khuẩn B. cereus có thể dẫn đến
tiêu chảy do độc tố 3 thành phần được tạo ra bởi chủng vi khuẩn đục thủng và giết
chết tế bào này. Độc tố bao gồm ba protein (3 thành phần) là rất hiếm, một trong số
đó là enterotoxin không tán huyết, còn được gọi là Nhe. Độc này được cho là độc tố
gây ngộ độc thực phẩm chính do B. cereus sản sinh ra. Nó được tìm thấy ở tất cả
các chủng B. cereus gây ngộ độc thực phẩm và trong gần như tất cả các chủng B.
cereus khác, ba protein trong các độc tố Nhe được gọi là NheA, NheB và NheC.
1.2.1.2. Staphycoccus trong không khí
Staphylococcus là lọai cầu khuẩn, bao gồm cả giống hiếu khí (Micrococcus,
Planococcus và Deinococcus), giống kị khí tuỳ nghi (Staphylococcus, Stomacoccus,
Streptococcus, Leuconostos, Pediococcus, Aerococcus và Gemella) và giống kị khí
(Peptococcus, Peptostreptococcus, Ruminococcus, Coprococcus và Sarcina). Họ
Micrococcaceae gồm bốn giống: Micrococcus, Stomacoccus, Planococcus và
Staphylococcus. Những đặc tính khác nhau của cầu khuẩn Gram (+) gồm: sự sắp
xếpcủa tế bào, hiếu khí bắt buộc, kị khí tuỳ nghi hay vi hiếu khí, kị kí bắt buộc,
phản ứngcatalaza, sự hiện diện cytochrom, sản phẩm lên men từ quá trình kị


khí,peptidoglycan, axit teichoic trong thành tế bào vi khuẩn (Scott E.M và cs,
2000). Staphylococcus là tụ cầu có khả năng gây bệnh rất lớn cho người và động
vật. Trên phương diện gây bệnh thì tụ cầu khuẩn được chia làm hai nhóm chính: có
men coalugaza khi xuất hiện trên môi trường thạch máu có màu vàng thì được gọi là
tụ cầu vàng và không có men coagulaza xuất hiện trên môi trường thạch máu có
màu trắng ngà được gọi là tụ cầu trắng. Chúng là tác nhân gây nhiều loại bệnh khi
chúng bám và cư trú các bộ phân của cơ thể như trên da, khoang miệng, gây viêm
phổi cấp tính nếu như bị hít phải. Trong thực phẩm vi khuẩn chỉ cần 1,0 x
2

10 CFU/g thức ăn đủ để bị ngộ độc, vi khuẩn này rất nguy hiểm nếu như chúng xuất
hiện trong môi trường không khí. Khi bị nhiễm trùng da, mô tế bào, áp xe do vi
khuẩn S. aureus khi mổ ra chúng tạo thành mủ có màu vàng, đặc, không hôi. Chúng
còn gây ra nhiều loại viêm nhiễm khác trong các bộ phận trong cơ thể khi chúng
theo các tuyến dịch hay vết thương hở[10]; [36].
1.2.2. Nấm và nấm mốc trong không khí
Giới nấm (Fungi) là nhóm sinh vật đơn ngành thuộc dạng tế bào nhân thực,
Cơ thể là đơn bào hoặc đa bào dạng sợi, có thành kitin (trừ một số ít có thành
xenluloza), không có lục lạp, Sống dị dưỡng hoại sinh, ký sinh và cộng sinh, sinh
sản chủ yếu bằng bào tử, bào tử thường không có lông và có thể có roi. Nấm phát
o

o

triển trong điều kiện có sẵn chất hữu cơ và ở nhiệt độ từ 25 ÷ 30 C, Ở 0 C thì nấm
o

không phát triển được, ở nhiệt độ 100 C giết chết nhiều loại nấm, trong hệ thống
phân loại 5 giới của RH, (Whittaker the five kingdom system) nấm thuộc giới riêng
rẽ được gọi là giới nấm, Theo Elizabeth Tootyll (1984) nấm mốc có khoảng 5.100
giống và hơn 50.000 loài đã được mô tả, nhưng ước tính có đến trên 250.000 loài
nấm có mặt trên trái đất này.
Nấm có nhiều loài như vậy có cả những loài có lợi và có cả những loài có
hại, còn tùy vào sự hiện diện của nó ở đâu, trong điều kiện nào và trên cơ chất gì.
Chúng sẽ tạo ra các chất ngoại độc tố và nội độc tố gây hại cho môi trường xung


quanh nó. Nấm có các dạng điển hình gồm nấm men và nấm sợi, chúng khác nhau
về nhiều đặc điểm sinh học.
Nấm men (Yeast) là sinh vật đơn bào, sinh sản bằng nảy mầm chồi hoặc phân
cắt. Hình dạng và cấu trúc của nấm ở thể đơn bào có hình trứng (thường là nấm
men), đa số có hình sợi, sợi có ngăn vách (đa bào) hay không có ngăn vách (đơn
bào). Sợi nấm thường là một ống hình trụ dài có kích thước lớn nhỏ khác nhau tùy
theo từng loài, Đường kính của sợi nấm thường từ 3 ÷ 5 µm, có khi dài đến 10 µm,
thậm chí đến 1 mm, Chiều dài của sợi nấm có thể tới vài chục cm, các sợi nấm phát
triển theo chiều dài theo kiểu tăng trưởng ngọn.
Liên quan đến gây bệnh của nấm thông qua 4 phương thức đó là: ký sinh,
gây bệnh với các hiện tượng dị ứng, gây bệnh do ăn phải thực phẩm nhiễm nấm và
độc tố của chúng, gây bệnh do ăn phải nấm độc. Nhiều loài phổ biến hiện nay thuộc
chi Aspergillus và Penicillium chúng phân bố rộng rãi trên trái đất nhiều loại cơ
chất tự nhiên, chúng có mặt khắp nơi trên trái đất. Theo E. Kister, M. Morelet
(2000) thì ước tính số loài đã hiện biết của chi Penicillium là khoảng 233 loài, chi
Aspergillus khoảng 185 loài. Một số lượng lớn đã được phát hiện những lợi ích
mang lại cũng có nhiều như, chúng tham gia và quá trình sản xuất công nghiệp
kháng sinh, công nghệ lên men, nhiều ứng dụng khác có lợi cho người và môi
trường cộng đồng. Bên cạnh đó có nhiều loài có hại, chất độc do nấm tạo ra gọi
chung là mycotoxin gây ảnh hưởng tới sức khỏe con người như các vấn đề dị tật
bẩm sinh, não, gan, thận[4]; [5]; [9]; [11]; .
1.2.2.1. Aspergillus trong không khí
Nấm Aspergillus là giống có khuẩn ty phân nhánh, có vách ngăn ngang và
phát triển chủ yếu trên bề mặt cơ chất, tế bào chất có nhiều nhân và những nhân này
có thể di chuyển qua lại giữa các tế bào với một lỗ nhỏ ở vách ngăn. Khuẩn ty và sự
hình thành cọng mang túi bào tử của Aspergillus. Chúng sinh sản vô tính bằng sự
hình thành các cọng bào tử từ tế bào chân với túi có cuống (vehicle), thể bình và
bào tử đính (conidia).


1.2.2.2. Penicillium trong không khí
Giống Penicillium có khuẩn ty phân nhánh, có vách ngăn giữa 2 tế bào với
một lỗ nhỏ để các phần tử trong tế bào chất thông thường. Cọng bào tử phân nhánh
với các thể bình cấp 1, 2 và 3...và tận cùng bằng các đính bào tử trần dễ dàng phát
tán trong không khí, đặc biệt đính bào tử có màu xanh lục đặc trưng cho giống
Penicillium.
1.2.2.3. Một số loài nấm khác trong không khí
Một số loài nấm khác thuộc giống Rhizopus, Mucor, Candida gây bệnh trên
người, Microsporum gây bệnh trên chó, A. fumigatus gây bệnh trên chim;
Saprolegnia và Achlya gây bệnh nấm ký sinh trên cá. Những loài nấm gây bệnh trên
cây trồng như Phytophthora, Fusarium, Cercospora[18].
1.3. ẢNH HƯỞNG CỦA VI SINH VẬT TRONG KHÔNG KHÍ TỚI SỨC
KHỎE CỘNG ĐỒNG
1.3.1. Ảnh hưởng của vi khuẩn đến môi trường và sức khỏe cộng đồng
Vi khuẩn hiếu khí là vi khuẩn có thể mọc và sống được khi có sự xuất hiện
của oxy. Vi khuẩn hiếu khí bao gồm rất nhiều loài, có những loại gây dị ứng, gây
bệnh truyền nhiễm, gây độc, nhóm vi sinh vật tồn tại một số lượng lớn trong môi
trường là một hiểm họa tiềm ẩn có thể bùng phát dịch bệnh bất cứ lúc nào, nếu như
khi gặp điều kiện môi trường sống thuận lợi những vi sinh vật gây bệnh này bùng
phát thành ổ dịch và nếu không kiểm soát kịp thời có thể trở thành đại dịch, những
bệnh có thể gặp phổ biến như viêm phổi cấp, lao, tả lỵ, thương hàn đó là những
bệnh thường gặp nhất, ngoài ra còn rất nhiều những bệnh khác có thể gặp đối với
những người mẫn cảm, hay cơ địa của người đó phù hợp với điều kiện sinh trưởng
và phát triển của loại vi sinh vật gây bệnh này, sự lây truyền bệnh truyền nhiễm gây
ra bởi vi sinh vật thông qua con đường không khí là rất khó kiểm soát, nó có thể
phát tán trong một không gian rộng lớn.
Trong không khí có rất nhiều loại vi khuẩn có cả những loài có lợi, nhưng
có không ít những loài gây hại cho sức khỏe của sinh vật, động vật và con người. Vi


khuẩn chủ yếu gây ra những bệnh như nhiễm trùng khác nhau và tốc độ gây bệnh
rất nhanh có thể gây tử vong nếu không kịp thời điều trị như hô hấp cấp tính (S.
aureus, và S. epidermidis) hay C. trachomatis gây ra bệnh mắt hột, Mycoplasma
pneumoniae

gây ra bệnh viêm phổi. Những loài gây ra dịch tả như (Vibrio

cholera). Còn rất nhiều những loại bệnh khác, nguyên nhân chính gây ra là do vi
khuẩn[10]; [13]; [14]; [15]; [19]; [24].
1.3.2. Ảnh hưởng của nấm đến môi trường và sức khỏe cộng đồng
, được hình thành khi nấm chuyển
hóa các chất dinh dưỡng có trong thức ăn và nguyên liệu. Sự hình thành nấm mốc
và độc tố của chúng có thể bắt đầu từ khi cây còn ở trên đồng, lúc thu hoạch, trong
khi bảo quản hoặc ngay cả trong quá trình chế biến thức ăn cho vật nuôi. Như vậy,
không nơi nào trên thế giới có thể thoát khỏi nấm mốc và độc tố từ chúng, tác hại
của chúng là vô cùng to lớn đối với năng suất vật nuôi và sức khỏe con người.
Các loại độc tố sinh ra từ các loại nấm mốc điển hình như:
Aflatoxin: Aflatoxin nhiễm nhiều trong khô dầu phộng, khô dầu dừa, bắp,
cám, tấm… do A. flavus và A.parasiticus sinh ra, độc tố này gây tổn thương ở gan,
thận, mật , nó cũng làm giảm khả năng tiết sữa, đẻ trứng và sức đề kháng ở gia súc,
gia cầm. Theo Tổ chức về bệnh ung thư Quốc tế aflatoxin được xếp vào danh sách
những tác nhân gây ung thư cho người.
Ochatoxin A: do A. ochraceus sinh ra, các nguyên liệu dễ nhiễm độc tố này
như cám gạo, lúa mì, bột mì, bắp, đậu nành, cà phê. Dư lượng ochratoxin cũng được
tìm thấy trong thịt heo và thịt gia cầm. Độc tố này gây hại đến gan và thận động vật.
Với nồng độ lớn hơn 1ppm có thể làm giảm sản lượng trứng ở gà đẻ, nồng độ lớn
hơn 5ppm có thể gây nên những tổn thương ở gan và ruột. Tương tự như aflatoxin,
độc tố này cũng gây nên sự giảm sức đề kháng và là tác nhân gây ung thư ở người.
Citrinin: Độc tố này do sinh ra bởi nấm P. citricum có nhiều trên tấm gạo để
mốc, độc tố này gây hại cho thận, gây hoại tử nhiễm trùng vì thế làm tổn hại đến
chất lượng quầy thịt.


Tricothecenes (T2-toxin):do F. tricinotum sinh ra thường nhiễm nhiều trong
bắp, tấm gạo bị mốc. Ảnh hưởng chính của các độc tố này là làm giảm tính thèm ăn
ở gia súc, kèm theo triệu chứng nôn mửa và làm giảm năng suất của động vật nuôi.
Heo là loài gia súc nhạy cảm với độc tố tricothecenes.
F2-Toxin(zearlenon): do F. roseum sinh ra, theo quan sát thấy nhiều trên
bắp, lúa mạch, lúa mì. Heo là loài động vật rất dễ quan sát, khi bị nhiễm độc thì âm
hộ bị sưng đỏ, đôi khi núm vú cũng sưng đỏ, có thể dẫn tới sa trực tràng và âm đạo,
tử cung nở rộng và có hiện tượng thoái hóa buồng trứng. Zearalenon gây
,t

. Zearalenone có tác dụng trực tiếp lên cơ quan sinh dục
cái gây sẩy thai, nhưng nó không có tác dụng làm giảm lượng thức ăn ăn vào như
tricothecenes [17]; [32].
Trong số các độc chất ở trên thì độc tố aflatoxin có mức nguy hiểm lớn nhất.
Aflatoxin bao gồm 6 loại khác nhau (B1, B2, G1, G2, M1 và M3), trong đó độc tính
cao nhất là aflatoxin B1. Sự nguy hiểm ở chỗ nó có khả năng gây hại chỉ với liều
lượng rất nhỏ, 1 kg thức ăn chỉ cần nhiễm 2 mg cũng đã đủ làm hỏng gan. Độc chất
o

này lại bền vững với nhiệt, nếu đem đun sôi 100 C ở nồi bình thường hoặc nhiệt độ
cao hơn ở nồi áp suất, hay nhiệt độ từ máy ép đùn viên thức ăn gia súc thì aflatoxin
vẫn không bị phân hủy.Ngoài khả năng tạo ra một số loại độc chất thì có một số
bệnh nguy hiểm đã được tìm thấy nguyên nhân là do các loại nấm gây ra.
Bệnh lý về bệnh nấm phổi được phát hiện từ cuối thế kỷ 19 và là bệnh có
nguy cơ tử vong rất cao. Bệnh Aspergillomas phần lớn gây nhiễm trùng ở phổi và
rất hiếm khí gặp tuy nhiên các nhà khoa học đã phát hiện ra một bệnh nhân tại Ý đã
bị mắc chứng bệnh này, khối nấm trong người bệnh nhân này quá lớn với chiều
rộng hơn 7 cm, và bênh nhân này được điều trị tại Bệnh viện Catania ở Ý. Nguyên
nhân gây ra chứng bệnh này là do bào tử vi nấm Aspergillus xâm nhập vào phổi qua


đường khí quản và tạo ra một lỗ hổng trong lá phổi, bào tử này cư ngụ ở đây và nẩy
mầm dẫn đến sưng phổi và bị ho lao nếu như không được phát hiện và điều trị kịp
thời. Trước đây cho rằng chỉ có tác nhân hóa học mới gây ra ngộ độc cấp tính cho
con người, còn các cá nhân sinh học chỉ có thể gián tiếp gây ra các bệnh tật cho con
người. Việc phát hiện và phòng chống là rất cần thiết đối với những loại vi nấm có
thể tạo ra nhưng ngoại độc tố tránh được nguy cơ lây nhiễm. Việt Nam lại có khí
hậu nóng ẩm là điều kiện rất phù hợp với sự sinh trưởng của các loài vi nấm gây
bệnh sinh trưởng mạnh, gần như quanh năm độ ẩm luôn ở mức cao 75 ÷ 80% vào
các tháng có độ ẩm tương đối gần 100%, đây là môi trường thuận lợi cho nấm và
các vi nấm gây bệnh phát triển mạnh, gây ảnh hưởng lớn đến sức khỏe con người và
trong môi trường lao động thì gây ảnh hưởng lớn đến người lao động[17]; [22];
[25]; [26]; [36].
1.4. PHƯƠNG PHÁP THU MẪU KHÔNG KHÍ
1.4.1. Phương pháp lấy mẫu tại hiện trường
Lấy mẫu là bước quan trọng cho một quy trình phân tích, quyết định sự
chính xác quy trình phân tích, khi lấy mẫu trong môi trường không khí là rất khó
khăn. Đặc biệt trong phân tích vi sinh trong không khí thì việc lấy mẫu lại rất khó
khăn, bị ảnh hưởng bởi rất nhiều yếu tố tác động ngoại cảnh, gây nhiễu trong không
khí khu vực cần đánh giá. Trên thế giới họ thường dùng hai phương pháp chính để
lấy mẫu vi sinh không khí là dựa trên nguyên tắc lắng hạt bụi (đạt đĩa thạch) và
phương pháp sử dụng lực bơm chân không để hút cưỡng bức. Mỗi phương pháp này
đều có ưu và nhược điểm, tùy mục đích sẽ sử dụng phương pháp nào cho phù hợp,
ô nhiễm không khí môi trường lao động rất đa dạng, việc lấy mẫu vi sinh trong khu
vực có công nhân làm việc có tính đại diện rất khó. Đối với vi sinh vật trong không
khí bị ảnh hưởng bởi sự lưu thông trong không khí, có điều kiện lấy nhiều vị trí sẽ
cho kết quả chính xác nhất[1]; [6].
Qua một số nghiên cứu đã được công bố trên thế giới thì đa phần sử dụng
các thiết bị lấy mẫu như thiết bị lấy mẫu Anderson, Rotorod, Burkard, thiết bị lấy


mẫu Burkard và rotorod thì dựa vào nguyên lý, sử dụng các vật liệu có độ bám dính
và dùng mô tơ quay tròn để các hạt bụi và các hạt sinh học lơ lửng trong không khí
có thể bám dính vào các vật liệu dính, sau đó thu các vật liệu dính này về đưa vào
môi trường nhân nuôi, tuy nhiên phương pháp lấy mẫu này thường kéo dài[6], [28].
Các thiết bị ra đời sau này đã được cải tiến rất nhiều và đã được sử dụng trong nhiều
nghiên cứu lấy mẫu vi sinh gây bệnh trong không khí đó chính là thiết bị Anderson.
Thiết bị này được phân tầng theo kích thước của hạt sinh học lơ lửng, mỗi tầng
được đặt vật liệu giữ lại các hạt sinh học lơ lửng, ở các tầng, đưa các vật liệu này
nuôi ủ phòng thí nghiệm và phân loại vi sinh vật khác nhau. Thiết bị Anderson được
phân thành 6 tầng mỗi tầng có khoảng kích thước khác nhau, tùy mục đích nghiên
cứu và sử dụng có thể dùng một tầng trong đó để có kích thước lỗ phù hợp, ngoài ra
còn có các loại thiết bị lấy mẫu của các hãng khác thiết kế và sản xuất như thiết bị
SAS[19]; [28]. Thiết bị này có nguyên lý giống với thiết bị lấy mẫu Anderson đó
vẫn là lấy mẫu bằng phương thức hút trực tiếp. Thiết bị lấy mẫu Spin Air sử dụng
nguyên lý này để lấy mẫu vi sinh không khí với kích thước lỗ 0,4 mm và có 400 lỗ
trên bề mặt, bốn chế độ quay đĩa, tốc độ là 100 lít/phút, sử dụng đĩa thạch 90 mm.
1.4.1.1. Nguyên lý phương pháp hút trực tiếp
Nguyên lý của phương pháplà dùng lực hút chân không để hút không khí đi
vào thiết bị và được lưu giữ các hạt bụi trong đĩa thạch. Tùy từng loại thiết bị sử
dụng loại vật liệu lọc khác nhau mà không khí được lọc qua lỗ lọc cho không khí đi
qua và giữ lại vi sinh vật trên vật liệu đó. Thiết bị lấy mẫu được nhiều tác giả sử
dụng nhiều nhất hiện nay là dạng thiết bị Anderson, method 0800 của NIOSH cũng
sử dụng thiết bị lấy mẫu Anderson 2 tầng để lấy mẫu. Phương pháp lấy mẫu
Anderson thì thiết bị lấy mẫu được hút bằng một bơm hút qua các tầng đặt môi
trường thạch với những kích thước lỗ khác nhau, thường thời gian lấy mẫu khoảng
o

5 ÷ 15 phút, đĩa thạch được lấy ra và đưa vào tủ ấm giữ ở nhiệt độ 37 ± 0,5 C trong
thời gian 1 ngày (đối với vi khuẩn) còn 3 ÷ 5 ngày đối với nấm mốc. Ưu điểm của
phương pháp này là có thể lấy mẫu ở kích thước nhỏ có thể đi trực tiếp vào phổi (2


÷ 4 µm) và với phương pháp lấy mẫu này cũng có thể lấy được cả những vi khuẩn
hiếu khí[6]; [28]; [36]. Nhiều thiết bị lấy mẫu có tốc độ rất lớn có thể đạt tới 180
lít/phút và có loại kép hai đầu lấy mẫu vẫn đạt tới 180 lít/phút cho mỗi bên, các thiết
bị này rất phù hợp để lấy mẫu trong khu vực có tốc độ lưu thông không khí lớn, vận
tốc chuyển động lớn. Nhờ thiết bị hiện đại như vậy việc lấy mẫu sinh học trong
không khí hiện nay rất dễ dàng và thuận tiện hơn, tuy nhiên chi phí đầu tư thiết bị
tăng lên dẫn đến chi phí thực hiện quan trắc môi trường cao.
1.4.1.2. Nguyên lý phương pháp đặt đĩa thạch
Vi sinh vật trong không khí thường bám vào các hạt bụi lơ lửng trong không
khí, các hạt bụi này dù rất nhỏ nhưng chúng cũng có trọng lượng nhất định, nên các
hạt bụi này sẽ rơi tự do tương tự như các vật có trọng lượng khác. Dựa vào nguyên
lý này nhà vi sinh vật học Robert Koch đã dùng các đĩa thạch môi trường để hứng
các bụi lơ lửng này đưa về phòng thí nghiệm để nuôi cấy phân lập. Vì thế phương
pháp này được gọi là phương pháp Koch. Phương pháp này kỹ thuật sử dụng đơn
giản và tiện lợi không cầu kỳ có thể đạt được ở mọi nơi, thường được sử dụng nhiều
trong các bệnh viện ở thế kỷ 20, chủ yếu để kiểm soát nhiễm khuẩn bệnh viện, bác
sỹ mổ và điều trị, nhà sinh học Robert Koch chuyên nghiên cứu về bệnh truyền
nhiễm, ông cho rằng sự lây nhiễm này lây truyền không chỉ ở các dụng cụ và quá
trình điều trị và chữa trị trong bệnh viện mà còn có khả năng lây lan qua không khí
và có thể dẫn đến những đại dịch trong một vùng nào đó, nếu như có sự lan truyền
các vi sinh vật gây bệnh này ra cộng đồng, gây nguy hiểm cho môi trường cộng
đồng. Robert Koch nghĩ rằng với những điều như vậy và dựa trên nguyên tắc trọng
lực thì chỉ cần đặt các đĩa thạch mở lắp trong khu vực bệnh viện là có bắt được các
hạt bụi có bào tử vi khuẩn bám trên đó, nuôi cấy trong điều kiện phòng thí nghiệm
sẽ biết được chúng thuộc loài nào. Chính những việc này sẽ có biện pháp phòng
chống việc lây nhiễm trong bệnh viện bằng con đường không khí, dựa trên cách
đánh giá chất lượng không khí đó có thể giám sát được chất lượng không khí khu


vực phòng mổ nhằm giảm thiểu nguy cơ bị lây nhiễm các vết mổ bởi nhưng vi
khuẩn gây bệnh, các vi khuẩn kháng kháng sinh[1].
1.4.1.3. Phương pháp lấy mẫu Impingers
Ngoài các kỹ thuật lấy mẫu trên môi trường rắn và các vật liệu như gelatin
còn có một kỹ thuật khác để thực hiện lấy mẫu vào dung dịch môi trường dinh
dưỡng lỏng, hay gọi là dung dịch đệm, dụng cụ sử dụng là ống impingers để thực
hiện lấy mẫu, nguyên tắc lấy mẫu theo dạng hấp phụ. Hiện nay thiết bị chuyên dụng
cho việc lấy mẫu sinh học bằng dung dịch được hãng thiết bị thí nghiệm SKC sản
xuất với các loại khác nhau và thiết bị có tốc độ lớn nhất với vận tốc hút mẫu 12 lít
trên phút, lấy mẫu trong một thời gian dài. Ưu điểm lấy mẫu theo phương pháp này
là có thể lấy trong thời gian dài có tùy theo mục đích của các nghiên cứu, số lượng
dung dịch sử dụng khoảng 15 ÷ 20 ml cho mỗi một lần lấy mẫu. Đối với phương
pháp này cũng rất thuận tiện cho việc lấy các mẫu sinh học khác như vi khuẩn, vi
nấm, nấm men, virus, hay các hạt sinh học như hạt phấn, hạt bào tử… các sản phẩm
tạo ra các loại nội độc tố và độc tố của nấm mốc. Mẫu lấy từ phương pháp này có
thể sử dụng cho các phương pháp hiện đại hiện nay như PCR, phương pháp Elisa,
ADN… xác định trực tiếp ra loại gì có nguy cơ gây bệnh như thế nào. Tuy nhiên
hiện nay tại Việt Nam chưa có nhiều ứng dụng để thực hiện theo phương pháp này
trong quan trắc môi trường, cũng như những nghiên cứu khác liên quan đến vi sinh,
hay mẫu sinh học không khí.
Lấy mẫu bằng phương pháp này dung dịch đệm hay trực tiếp là các môi
trường lỏng, sau khi lấy mẫu xong được đưa vào ống nghiệm và có thể sử dụng cho
việc nuôi cấy, cũng như có thể sử dụng cho các phương pháp test nhanh bằng
những kỹ thuật hiện đại. Đây cũng là phương pháp rất hữu ích cho việc nghiên cứu
các mẫu sinh học trong không khí và sử dụng để quan trắc chỉ tiêu sinh học trong
không khí ở nhưng khu vực có có sự lưu thông không khí nhỏ và vừa phải sẽ rất
hiệu quả, đồng thời phù hợp với những nghiên cứu về xác định DNA các mẫu sinh
học tồn tại trong không khí, sử dụng trong nghiên cứu miễn dịch hay nghiên cứu về


các tác nhân gây dị ứng như bụi phấn hoa, hay ứng dụng trong các mẫu nghiên cứu
về sinh hóa[21].
1.4.2. Phương pháp phân tích tại phòng thí nghiệm
Tại Việt Nam cũng đã có những nghiên cứu cắt ngang về lĩnh vực phân tích
vi sinh vật tuy nhiên nó vẫn chưa có quy định nào thống nhất sử dụng rộng rãi vẫn
chỉ mang tính chất ở cấp độ thường quy của Viện Y học lao động, chưa xây dựng
thành tiêu chuẩn quốc gia hay tiêu chuẩn ngành. Tuy nhiên trong những năm qua
cũng có những nghiên cứu về chất lượng không khí của những phòng khám và
những phòng chức năng trong bệnh viện tại Việt Nam. Mới đây nhất vào năm 2009
Nguyễn Quốc Tuấn đã sử dụng máy hút MAS 100 của hãng Merck để thực hiện
việc lấy mẫu vi sinh không khí nuôi ủ và phân loại dựa trên hình thái khuẩn lạc mọc
trên môi trường chọn lọc để nghiên cứu khảo sát ô nhiễm vi sinh trong không khí
phòng phẫu thuật, phòng hồi sức của 13 bệnh viện khu vực Thành phố Hồ Chí
Minh. Cũng trong năm này 2010, Nguyễn Quỳnh Mai đã nghiên cứu so sánh giữa 2
phương pháp đánh giá chất lượng môi trường không khí là phương pháp đặt đĩa
thạch và phương pháp hút không khí bằng máy,nhận xét về ưu và nhược điểm của
từng phương pháp, tuy nhiên với bài báo công bố đó chưa thể nói lên được độ chính
xác của phương pháp phân tích. Trước đó Từ Hải Bằng và các cộng sự cũng đã
bước đầu đánh giá chất lượng môi trường không khí tại các phòng phân tích vi sinh,
trong nghiên cứu này nghiên cứu mức độ tập trung và phân tán của vi khuẩn và nấm
trong không khí trong phòng thí nghiệm vi sinh bằng phương pháp đặt đĩa thạch lấy
mẫu. Trong nghiên cứu này tác giả đã sử dụng môi trường thạch dinh dưỡng cho
thu thập vi khuẩn và thạch Sabouraud để thu thập và nuôi dưỡng nấm. Nghiên cứu
này tập trung chính vào việc nghiên cứu chất lượng môi trường không khí của
phòng thí nghiệm, cũng đã đưa ra được giả thuyết về chất lượng vi khuẩn và nấm
trong không khí phòng thí nghiệm của mùa đông cao hơn mùa hè và cũng đã chỉ ra
mức độ sạchtại các phòng thí nghiệm vi sinh hiện nay chưa đạt được tiêu chuẩn khi
so sánh với các tiêu chuẩn hiện có tại các quốc gia khác. Qua các nghiên cứu


trêncũng là những cơ sở để tiếp tục các nghiên cứu độ chính xác của phương pháp
lấy mẫu phân tích vi sinh không khí phục vụ cho lĩnh vực quan trắc môi trường lao
động[1]; [6]; [27].
Hiện nay với sự phát triển nhanh chóng của ngành công nghệ sinh học, sinh
học phân tử, đã có thể phân lập và định dạng đến loài của các vi sinh vật một cách
nhanh chóng và có độ chính xác rất cao, với phương pháp giải trình tự gen tiên tiến
hiện có thể tìm ra được các gen gây bệnh của vi sinh và gen quy định độc tố của các
vi sinh. Qua đây cảnh báo chất lượng môi trường có nguy cơ tiềm ẩn sự nguy hiểm
khi có mặt của những loại vi sinh đó trong không khí.
1.4.3. Phương pháp sinh học phân tử
Hiện nay, bên cạnh những phương pháp định loại vi sinh vật truyền thống, các
nhà khoa học còn sử dụng các kỹ thuật sinh học phân tử để phân loại dựa trên trình
tự gen. Trong lĩnh vực vi sinh vật và vi sinh phân tử việc giải trình tự gen là hết sức
quan trọng, cho phép định danh, phân loại vi sinh vật tới cấp độ phân tử. Sử dụng
phương pháp sinh học phân tử để khẳng định chủng vi khuẩn tìm thấy trong không
khí có độ chính xác rất cao, khẳng định được chính xác vi khuẩn có nguy cơ gây
bệnh và nấm mốc có nguy cơ tạo ra chất độc ảnh hưởng tới thực phẩm, các chủng
gây bệnh cho người. Đối với vi khuẩn và xạ khuẩn xác định trình tự gen 16S rARN
là phương pháp đang được dùng phổ biến. Gen này có mặt trong tất cả các tế bào,
chứa vùng bảo thủ cao và vùng biến đổi cho phép phân biệt giữa các loài khác nhau.
Với nấm mốc trình tự gen 28S rARN là nhiều người sử dụng hiện nay, giải trình tự
gen đối với nấm mốc. Giải trình tự gen cho thấy đọan gen hay bộ gen có độ tương
đồng là bao nhiêu so sánh gen chủng này trong ngân hàng gen sẽ xác định chính xác
chúng thuộc chủng vi sinh nào. Sử dụng phương pháp này để xác định vi sinh gây
bệnh và ngộ độc thực phẩm đang có mặt trong không khí môi trường lao động, cảnh
báo cho người lao động có biện pháp phòng tránh tiếp xúc với môi trường ô
nhiễm[30]; [31]; [34].


1.4.4. Phương pháp vận chuyển và bảo quản mẫu
Bảo quản mẫu trong quá trình vận chuyển mẫu lấy từ hiện trường di chuyển
về phòng thí nghiệm luôn đảm bảo không xảy ra sự ảnh hưởng đến mẫu thử trong
quá trình vận chuyển, sẽ làm sai khác kết quả quan trắc. Đảm bảo chất lượng kết
quả phân tích nấm mốc và TVKHK trong không khí, điều kiện bảo quản phải đảm
o

bảo thùng đựng vô khuẩn (thùng hút chân không là tốt nhất) và nhiệt độ 4 C. Mẫu
bioaerosol ở đây thu thập được là đĩa thạch hoặc các tấm gelatin được hấp phụ để
bám dính các hạt bụi lơ lửng. Qua hồi cứu thùng đựng mẫu hầu hết các đĩa mẫu
được đậy lắp ngay sau khi đã lấy mẫu, được gói đĩa thạch lại bằng một giấy bản
mỏng đã được khử trùng hoặc dùng paraffin để phủ kín khe hở giữa hai lắp đĩa Petri
hoặc gắn kín các ống nghiệm (đối với việc lấy mẫu dung dịch) và được đưa vào
o

thùng bảo ôn nhiệt (4 C), đảm bảo độ vô trùng. Trong quá trình vận chuyển luôn có
sử dụng mẫu trắng vận chuyển đối chứng. Tuân thủ áp dụng theo quy trình QA/QC
trong quá trình vận chuyển và bảo quản mẫu thử về phòng thí nghiệm để đảm bảo
chất lượng của phép thử có độ chính xác.
Năm 2013 ở Việt Nam đưa Thông tư quy định đảm bảo chất lượng và kiểm
soát chất lượng trong quan trắc môi trường, dùng cho các đơn vị quản lý nhà nước
trung ương và địa phương, các trạm quan trắc, các đơn vị tham gia hoạt động trong
lĩnh vực môi trường, để có được báo cáo kết quả quan trắc môi trường đảm bảo chất
lượng, độ chính xác cao.
1.5. ÁP DỤNG QA/QC TRONG QUY TRÌNH PHÂN TÍCH
Bảo đảm chất lượng (QA) trong quan trắc môi trường là một hệ thống quản
lý và kỹ thuật trong một tổ chức nhằm đảm bảo cho hoạt động quan trắc môi trường
đạt được các tiêu chuẩn chất lượng đã quy định.
Kiểm soát chất lượng (QC) trong quan trắc môi trường là thực hiện các biện
pháp, theo dõi và kịp thời điều chỉnh để đạt được độ tập trung và độ chính xác của
phép đo nhằm đảm bảo cho hoạt động quan trắc môi trường đạt các tiêu chuẩn chất
lượng theo quy định.


Áp dụng QA/QC trong quan trắc môi trường là một trong những tiêu chí rất
quan trọng đảm bảo cho chương trình quan trắc, cũng như các quy trình phân tích
đảm bảo được chất lượng, độ chính xác cao. Trong việc xây dựng quy trình hay
phương pháp phân tích việc đưa QA/QC vào nghiên cứu, đánh giá, khảo sát độ
đúng độ chính xác của phương pháp đó trong thực tiễn áp dụng là rất chuẩn xác và
có độ tin cậy cao. Áp dụng QA/QC trong từng khâu của một quy trình là mục tiêu
giảm thiểu, giám sát tất cả những sai sót trong từng bước thực hiện đó, QA/QC
trong quá trình lấy mẫu cần ngay từ những việc nhỏ nhất đó là thiết lập cỡ mẫu, có
lấy mẫu trắng, mẫu đối chứng, lấy mẫu vị trí nào, chiều cao khi lấy mẫu, sau đó đến
dụng cụ lấy mẫu, vật liệu hấp phụ, môi trường lấy mẫu, dụng cụ bảo quản sau khi
lấy mẫu, sổ tay hướng dẫn cho nhân viên thực hiện lấy mẫu luôn bảo đảm theo tiêu
chuẩn đặt ra, sổ ghi lại nhật ký lấy mẫu, ký hiệu mẫu để mã hóa và nhận dạng sau
khi đưa về phòng thí nghiệm, thiết bị lấy mẫu tại hiện trường đã đảm bảo về độ vô
trùng, bảo dưỡng và hiệu chuẩn trước khi đưa đi lấy mẫu chưa, như vậy tất cả các
bước này luôn luôn phải tuân thủ theo tiêu chuẩn hiện hành yêu cầu, QA/QC áp
dụng quá trình lấy mẫu cần phải thiết kế được mẫu trắng cho dụng cụ chứa mẫu,
mẫu trắng dụng cụ lấy mẫu, mẫu trắng vận chuyển.
Áp dụng QA/QC trong phòng thí nghiệm để phép thử đảm bảo độ chính xác
cao, ngoài việc lấy mẫu tại hiện trường đảm bảo chất lượng thì tại phòng thí nghiệm
cũng phải đảm bảo chất lượng tương tự như vậy thì mới có được kết quả có độ
chính xác cao. Trong phòng thí nghiệm phải đảm bảo các thiết bị trong phòng thí
nghiệm đảm bảo là đã thực hiện hiệu chuẩn đầy đủ và tuân thủ quy trình thời gian
bảo dưỡng và hiệu chỉnh khi cần thiết. Đối với những phép thử vi sinh cần có phân
biệt rõ ràng khu vực chuẩn bị môi trường nuôi cấy, khu vực cấy mẫu đảm bảo độ vô
trùng, khu vực bảo quản môi trường luôn đảm bảo tuân thủ yêu cầu điều kiện môi
trường đảm bảo chất lượng hóa chất. Khu xử lý mẫu vi sinh sau khi thử nghiệm,
chất thải hóa học và môi trưởng nuôi cấy bị hỏng… tất cả nhưng điều kiện như vậy


đã được quy định rõ trong QA/QC. Tuân thủ chương trình này để đảm bảo chất
lượng cho phép thử.
1.6. SỰ CẦN THIẾT TRONG NGHIÊN CỨU VI SINH KHÔNG KHÍ
Hiện nay mức độ ô nhiễm môi trường không chỉ ngày một tăng, ô nhiễm
nước, ô nhiễm đất, khói bụi rất lớn, bụi vô cơ, bụi lơ lửng, gây ô nhiễm không khí
nghiêm trọng và mức độ ô nhiễm các hạt bụi sinh học trong không khí cũng là rất
lớn và lại chưa được ai quan tâm nhiều. Mức độ ô nhiễm ngày càng lớn như bệnh
viện, ở các vùng lân cận và các tòa nhà văn phòng, ảnh hưởng tới người lao động,
trong các nhà máy sản xuất thực phẩm, phân bón, bãi rác công cộng. Qua hồi cứu về
phương pháp đánh giá chất lượng môi trường không khí ô nhiễm vi sinh, thấy rằng
ở Việt Nam chưa hề có công bố tiêu chuẩn quốc gia, tiêu chuẩn ngành, về phân tích
TVKHK và tổng nấm trong không khí để áp dụng rộng rãi trong cả nước cho công
tác quan trắc và phân tích TVKHK và tổng nấm trong không khí môi trường lao
động cũng như môi trường xung quanh. Hiện tại chỉ có một số nghiên cứu đánh giá
chất lượng phòng khám bệnh viện và phòng thí nghiệm vi sinh, ngay cả quy chuẩn
áp dụng cũng chư có để so sánh mức độ ô nhiễm vi sinh trong không khí. Trong khi
đó ở nước ta, hiện chưa có phương pháp tiêu chuẩn để xác định thông số tổng vi
khuẩn hiếu khí và tổng số nấm trong môi trường không khí, dẫn tới việc rất khó
khăn để xác định được mức độ ô nhiễm về mặt sinh học trong không khí như thế
nào. Vì vậy việc “Nghiên cứu xây dựng quy trình và đánh giá sự có mặt của nấm
mốc và vi khuẩn hiếu khí trong không khí môi trường lao động” là nhiệm vụ cần
thiết phục vụ quan trắc môi trường lao động.
1.7. GIỚI HẠN CHO PHÉP MẬT ĐỘ VI SINH TRONG KHÔNG KHÍ
Tại Việt Nam hiện giờ chưa có quy chuẩn bắt buộc áp dụng nào hiện nay ngay
cả áp dụng cho bệnh viện vẫn chưa có quy chuẩn nào, dựa trên các tham khảo các
nước các tổ chức và các quốc gia khác trên thế giới. Dưới đây là bảng tiêu chuẩn áp
dụng của một số tổ chức và một số quốc gia trên thế giới.


Bảng 1.1.Bảng tiêu chuẩn áp dụng giới hạn cho phép vi sinh không khí [19]; [35]
STT

Tổ chức, quốc gia

Vi khuẩn

Nấm

Tổng bioaerosols
(Vi khuẩn + Nấm)

1

Braxin

-

750

-

2

Canada

-

150

-

3

Trung Quốc

-

-

4

Phần Lan

4.500

-

-

5

Đức

10.000

10.000

-

6

Hàn Quốc

-

-

800

7

Bồ Đào Nha

8

Hà Lan

9

Nga

2.500 ÷ 7.000

b

500
10.000

-

10.000

-

2.000 ÷
c
10.000

-

10.000
e
1.000

1.000

-

-

1.000

g

-

d

10

Thụy sĩ

11

Mỹ

12

Tổ chức Y tế thế
giới (WHO)

500

-

13

Liên minh châu Âu
(EU)

10.000h
i
2.000

10.000
i
2.000

-

14

Viện Quốc gia về
vệ sinh an toàn
thực phẩm Mỹ
(NIOSH)

-

-

1.000

15

ACGIH

500

-

-

a

h

b

Ghi chú: Bao gồm nhiều loài; Phụ thuộc vào địa điểm cụ thể như khách sạn, rạp
c

chiếu phim, thư viện, bảo tàng; Không có gì đặc biệt nhưng có thể nhìn thấy hỏng và
d

e

ngửi thấy mùi; : Phụ thuộc vào từng loài nấm đặc biệt; ; Dạng tế bào vi khuẩn hiếu
g

h

i

khí; ; Ngưỡng giới hạn không có trong bảng. Cho nhà riêng; Cho vị trí trong nhà
không thuộc khu công nghiệp.


CHƯƠNG II. VẬT LIỆU VÀ PHƯƠNG PHÁP
2.1. VẬT LIỆU NGHIÊN CỨU
2.1.1. Đối tượng nghiên cứu
Chủng giống vi sinh vật:Chủng chuẩn được sử dụng là vi khuẩn được mọc
tốt nhất trên môi trường MacConkey. Trong nghiên cứu này chủng chuẩn được sử
dụng đối chứng dương cho môi trường vi khuẩn là: E. coli ATCC® 25922, E.
TM

TM

aerogenes ATCC® 13048 , sử dụng chủng chuẩn S. aureus ATCC®25923 thực
hiện đối chứng âm cho các thí nghiệm, đồng thời dùng chủng chuẩn này làm đối
chứng dương để đánh giá chất lượng môi trường thạch máu. Chủng chuẩn cho môi
trường nấm và nấm men là chủng phổ biến hiện nay đó là A.brasiliensis
TM

ATCC®16404 .
Môi trường không khí tại Công ty Proconco
2.1.2. Thiết bị và hóa chất chính
2.1.2.1. Thiết bị chính
Thiết bị lấy mẫu vi sinh trong không khí: Spin Air (IUL), bao gồm 2 loại vận
tốc hút khí là 100 lít/phút và 60 lít/phút và có 4 chế độ quay vòng chậm trong quá
trình lấy mẫu, số lượng lỗ trên lắp lấy mẫu là 400 kích thước lỗ là 0,7 mm.
Thiết bị trong phòng thí nghiệm bao gồm: Tủ ấm, Đức.Máy khuấy từ IKA,
Ý. Kính hiển vi soi nổi Bel, Ý. Kính hiển vi sinh học Nikon E100, Nhật Bản.Tủ cấy
vi sinh, hệ thống phòng sạch và an toàn sinh học tại Viện Nghiên cứu KHKT Bảo
hộ lao động. Máy đếm khuẩn lạc SC 06 Bibby, Anh.
Dụng cụ thí nghiệm: đĩa Petri (90cm và 100 cm), ống đong, bình tam
giác,các dụng cụ để đi hiện trường: chân máy, các đĩa, dụng cụ bảo hộ lao động tiệt
trùng tại hiện trường.Thùng đựng môi trường đi hiện trường và thùng đựng mẫu đã
lấy ngoài hiện trường.Que cấy vi sinh, đèn cồn.Găng tay giầy ủng, khẩu trang y tế
dành cho cấn bộ thực hiện lấy mẫu và phân tích tại phòng thí nghiệm.
2.1.2.2. Hóa chất chính
+ Cặp mồi cho phân loại vi khuẩn:
Pr16F: AGAGTTTGATCCTGGCTCAG
Pr16R: TACGGTTACCTTGTTACCGACTT

+ Cặp mồi cho phân loại nấm mốc:
NL1 (5 -GCATATCAATAAGCGGAGGAAAAG-3
; NL4 (5'-GGTCCGTGTTTCAAGACGG-3 ')


2.1.3. Môi trường nuôi cấy
Môi trường nuôi cấy trong thí nghiệm này sử dụng các loại môi trường rắn
(môi trường thạch): môi trường MacConkey, môi trường Sabouraud, môi trường
thạch máu, các thành phần môi trường được sử dụng hầu hết là của hãng Merck, có
đầy đủ chứng nhận chất lượng sản phẩm của hãng[1]; [2]; [3]; [6]; [20].
Môi trường MacConkey cơ bản (g/l): Pepton 20; lactoza 10; muối mật 1,5;
o

NaCl 5; thạch 20; nước cất 1.000 ml; pH 6,8 ÷7,0, khử trùng 121 C, 15 phút.
Môi trường thạch máu (g/l): Thạch 15; pepton 5; meat extract 3; máu thỏ100
o

ml; nước cất 1.000 ml; điều chỉnh pH 7,4÷7,6, khử trùng121 C,15 phút. Để nguội
o
45÷ 50 C, cho 50ml máu vào quay tròn bình cho máu hòa tan đều trong thạch. Màu
thạch đỏ tươi là đạt tiêu chuẩn. Nếu môi trường màu ngả đen là máu đã chín. Để
o

nguội 45÷50 C đổ 20ml/đĩa.
Môi trường Sabouraud (g/l): Pepton 10; glucoza 20; thạch 20; nước cất 1.000
o

ml; pH 5,4 ÷ 5,8 khử trùng 121 C, 15 phút.
Môi trường MEA (g/l): Pepton 10; glucoza 20; thạch 20; nước cất 1.000 ml;
o

pH 5,0 ÷ 5,5;khử trùng 121 C, 15 phút.
Môi trường TSA (g/l): Pepton 10; Soy 20; thạch 20; nước cất1.000 ml; pH
o

6,8 ÷ 7,2khử trùng 121 C, 15 phút.
Môi trường Czapek (g/l): NaNO3 3,5; K2HPO4 1,5; MgSO4 0,5; KCl 0,5;
o

FeSO4 0,1; glucoza 80 g; thạch 20;pH 4,5 ÷ 5,5 khử trùng 121 C, 15 phút.
2.2. PHƯƠNG PHÁP NGHIÊN CỨU
2.2.1. Phương pháp xây dựng quy trình phân tích
Để xây dựng quy trình phân tích cần có các bước nghiên cứu đánh giá tuần
tự từ các yếu tố ảnh hưởng đến bước lấy mẫu và nuôi cấy trong phòng thí nghiệm
luôn đảm bảo độ chính xác. Mục tiêu là xây dựng quy trình phân tích dùng phổ biến
hơn trong điều kiện khác nhau của các phòng thí nghiệm tại Việt Nam, cũng như
các điều kiện thực tế. Những vị trí cần quan trắc phù hợp với phương pháp lấy mẫu
nào. Qua quá trình hồi cứu, nghiên cứu các tài liệu trong nước và nước ngoài như
nghiên cứu hướng dẫn của NIOSH, đưa ra được quy trình phân tích vi sinh trong
không khí được hình thành với sáu bước như sau:


Chuẩn bị môi trường nuôi cấy và thiết bị lấy mẫu,dụng cụ
bảo quản mẫu, môi trường, mẫu trắng và mẫu đối chứng

Lấy mẫu hiện trường, sử dụng thiết bị lấy mẫu vi sinh
không khí, tốc độ lấy mẫu100 lít phút

Chuyển mẫu từ hiện trường về phòng thí nghiệm, đặt
mẫu trong thùng kín (thùng hút chân không là tốt nhất) Điều
kiện nuôi cấy trong phòng thí nghiệm

Nuôi ủ tại phòng thí nghiệm, điều kiện nuôi cấy trong
o

phòng thí nghiệm, tổng nấm 28 ± 0,5 C, tổng vi khuẩn hiếu
o
khí 37 ± 0,5 C

Đếm khuẩn lạc trên bề mặt đĩa thạch Petri
Tính kết quả bằng công thức 2.2 (mục 2.2.4.2.)

Phân loại vi sinh vật, chọn khuẩn lạc đặc trưng cấy sang
môi trường chọn lọc để thuần và phân loại vi sinh vật
Hình 2.1.Sơ đồ phân tích tổng nấm và tổng vi khuẩn hiếu khí trong môi trường
không khí
Các bước xây dựng quy trình phân tích trong phòng thí nghiệm cần phải xác
định được từng bước thực hiện như sau, nghiên cứu khảo sát môi trường chuẩn cho
nuôi cấy vi khuẩn hiếu khí phù hợp nhất với điều kiện nghiên cứu tại Việt Nam.
TM
Bước 1:Dùng các chủng vi khuẩn E. coli ATCC® 25922 , E. aerogenes
TM

ATCC® 13048 cấy lên các môi trường MacConkey, TSA, NA, để xác định môi
trường này phù hợp với quy trình nghiên cứu. Còn với S. aureus
TM

ATCC®25923 sử dụng để cấy lên môi trường thạch máu, đây là loại vi sinh vật


TM

đặc trưng cho môi trường thạch máu. Chủng nấm A.brasiliensis ATCC®16404
chọn môi trường phù hợp với quy trình phân tích [2]; [6]; [9]; [21]; [28].
Bước 2: Lấy mẫu tại hiện trường là công việc rất quan trọng, chọn vị trí
chung nhất của khu vực cần lấy mẫu, tránh cản trở các vật dụng xung quanh, vị trí
lấy mẫu mang tính đại diện cho khu vực. Lấy mẫu bằng thiết bị lấy mẫu
Bước 3: Mẫu được lấy tại hiện trường xong cần bọc kỹ bằng giấy bản làm
sạch đặt vào thùng đựng mẫu (thùng đựng mẫu chọn thùng rút chân không là tốt
nhất) đặt những viên đá không để đảm bảo điều kiện bảo quản mẫu nhiệt độ thấp.
Chuyển ngay về phòng thí nghiệm trong thời gian ngắn nhất không không quá 12
giờ sau khi lấy mẫu là tốt nhất.
Bước 4: Phân tích tại phòng thí nghiệm, mẫu được chuyển về phòng thí
o

nghiệm chuyển vào 2 tủ nuôi khác nhau một tủ nuôi điều kiện nhiệt độ 37 C ± 0,5
o

o

C và tủ nuôi điều kiện nhiệt độ 28 ± 0,5 C. Thời gian nuôi ủ lần lượt là tổng vi
khuẩn hiếu khí là 24 ÷ 48 giờ, nếu không mọc thì mẫu đó âm tính.
Bước 5: Đọc kết sau khi nuôi ủ một ngày đối với tổng vi khuẩn hiếu khí,
đếm tất cả khuẩn lạc đã mọc trên bể mặt đĩa thạch, các khuẩn lạc chập vào nhau
được tính làm một khuẩn lạc, có nhận xét phân loại những khuẩn lạc có màu sắc
giống nhau để cảnh báo chất lượng môi trường không khí ở mức ô nhiễm như thế
nào có tiếp tục thực hiện đánh giá tiếp theo. Sau 3 ngày bỏ tổng nấm ra đếm, tương
tự như đối với vi khuẩn hiếu khí đếm tất cả khuẩn lạc mọc riêng rẽ những khuẩn lạc
mọc chập nhau được tính làm một khuẩn lạc (hoặc có thể lật ngược đĩa thạch đếm
chân ăn sâu đĩa thạch). Tính kết quả sử dụng công thức 2.2 tình kết quả đối với
phương pháp lấy mẫu bằng thiết bị định lượng được lượng không khí đã lấy. Sử
dụng công thức 2.1 cho phương pháp lấy mẫu đặt đĩa thạch tĩnh [16].
Bước 6: Sử dụng khóa phân loại Bergey’s, nhận định vi sinh vật ấy thuộc
loại nào có chủng gây độc, gây bệnh tồn tại trong không khí thực hiện quan sát hình
thái khuẩn lạc nhận định, dùng các kỹ thuật sinh học để phân loại [20].
Xây dựng quy trình phân tích tổng vi khuẩn hiếu khí và tổng nấm trong
không khí môi trường lao động. Tiến hành lựa chọn các thông số để xác định tính
chính xác của quy trình phân tích này. Qua tham khảo cuốn sách thẩm định các
phương phân tích hóa học và vi sinh vật nghiên cứu này đã lựa chọn thông số độ lặp
lại, độ tái lặp và thông số nữa để chứng minh độ chính xác của quy trình này là độ
không đảm bảo đo [9], [10].


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×