Tải bản đầy đủ

Nghiên cứu đặc điểm mô bệnh học, hóa mô miễn dịch và tình trạng methyl hóa gen RASSF1A trong ung thư biểu mô tuyến tiền liệt tóm tắt tiếng anh 4 12 2018

MINISTRY OF EDUCATION
AND TRAINING

MINISTRY OF
NATIONAL DEFENSE

MILITARY MEDICAL UNIVERSITY
---------

VI THUAT THANG

STUDY ON HISTOPATHOLOGICAL FEARURES,
IMMUNOHISTOCHEMISTRY AND METHYLATION
OF RASSF1A GENE IN PROSTATE CANCER

Speciality: Biomedical Sciences
Code: 9720101

THE MEDICAL DOCTORAL THESIS

Ha Noi – 2018



WORKS ARE COMPLETED
AT MILITARY MEDICAL UNIVERSITY

Name of supervisors:
1. Prof. Dr. Nguyen Dinh Tao, MD. Ph.D
2. Dr. Nguyen Ngoc Hung, MD.

Reviewer 1:
Reviewer 2:
Reviewer 3:

Assoc. Prof. Nguyen Van Hung, MD. Ph.D.
Assoc. Prof. Quan Hoang Lam, MD. Ph.D.
Assoc. Prof. Trinh Tuan Dung, MD. Ph.D.

The thesis will be protected before the Board of thesis
dissertation on the day: / /

A thesis can be found at:
1. National Library
2. Library of the Military Medical University


1
INTRODUCTION TO THESIS
1. Set the problem
Prostate cancer (Pca) is common in men over age of 65, the
disease is occult. Most cases were detected accidentally by
histopathological examination. In Vietnam, the standard age rate in
2012 was 3.4/100000 people and queued the 10 th in cancer in men.
Pca can be treated effectively if the disease is detected early.
Therefore, the finding of early detection methods, accurate diagnosis,
proper assessment of histopathological lesions by a standard and a
uniform classification is essential to the development of therapeutic
approaches and prognosis of this disease.
Several studies have shown that the RASSF1A gene
methylation occurs at an early stage in the formation and progression
of the Pca. Thus, RASSF1A gene methylation marker is being


considered to Pca. In Vietnam, studies on DNA methylation in cancer
have
been
carried
out
lately,
histopathological
and
immunohistochemistry studies of Pca according to the 2004 World
Health Organization (WHO) classification of tumors of the prostate
are lacking. Based on that, we do the following:
a. Study on some histopathological features of prostate
carcinoma at Military Hospital 103 according to the 2004 WHO
classification.
b. Determine the expression of some immunological markers
and methylation status of the RASSF1A gene and compare with some
histopathological features in prostate carcinoma.
2. New contributions of the thesis
+ Study on RASSF1A methylation status in some cases of
adenocarcinoma of the prostate.
+ Compare RASSF1A methylation status with some
histopathological features in prostate carcinoma.
+ Simultaneous staining using antibodies against PSA,
CK34betaE12, p63, CK7, CK5/6 and actin in prostate carcinoma.
3. Structure of the thesis


2
The thesis is 135 pages including: Introduction (2 pages);
Chapter 1- Document overview: 40 pages; Chapter 2- Subjects and
Methods: 20 pages; Chapter 3- Research results: 31 pages; Chapter 4Discussion: 40 pages; Conclusion: 2 pages; Request: 1 page; List of
articles: 1 page. The thesis has 27 tables of data, 1 diagram, 13
figues, 25 images, 148 references (25 in Vietnamese, 123 in English),
annexes to research forms and patient lists.
Chapter 1. OVERVIEW OF DOCUMENTS
1.1. A brief description of the histology of the prostate and
classification of prostate cancer
1.1.1. Histology
Histologically the structure of prostate consists of acinus,
branched ducts and prostate urethral ducts. The acinus and ducts are
lined by an secretary inner cell layer and an outer basal cell layer. The
prostate gland does not have myoepithelium, the acinus and ducts are
surrounded by smooth muscle, fibroblasts and collagen fibers. The
acinus and ducts contain faint pink secretions and corpora amylacea.
The main ducts are lined by urothelial epithelium.
2.1.2.
The 2004 WHO histological classification of
tumours of the prostate
Carcinoma of the prostate including adenocarcinoma,
urothelial carcinoma, squamous cell carcinoma, basal cell carcinoma.
1.2. Carcinoma of the prostate, prostatic intraepithelial neoplasia
and Gleason grading system
1.2.1. Adenocarcinoma of the prostate
* Adenocarcinoma: Gland-forming Pca typically contain
glands that are more crowded than in benign prostatic tissue,
although there is overlap with certain benign mimickers of Pca.
Glands of adenocarcinoma of the prostate typically grow in a
haphazard fashion. Glands oriented perpendicular to each other and
glands irregularly separated by bundle of smooth muscle are
indicative of an infiltrative process. Another pattern characteristic of
an infiltrative process is the presence of small atypical glands situated
in between larger benign glands with the loss of glandular


3
differentiation and the formation of cribriform structures, fused
glands, and poorly formed glands the distinction between benign
glands based on the architectural pattern becomes more apparent.
Tumors composed of soild sheets, cords of cells, or isolated
individual cells characterized undifferentiated Pca.
Nuclei in Pca range from those indistinguishable from benign
prostatic epithelium to those with overt malignancy. In most Pca,
there are cytological difference in the malignant glands when
compared to the surrounding benign glands. Nuclear enlargement
with prominent nucleoli is a frequent the finding, althouth not every
cancer cell will display these features. Some neoplastic nuclei lack
prominent nucleoli, yet are enlarged and hyperchromatic. Pca nuclei,
even in cancers which lack glandular differentiation, show little
variability in nuclear shape or size from one nucleus to another.
Mitotic figures may be relatively common in high grade cancer, yet
are infrequent in lower grade tumors. The cytoplasm is brighter than
the benign gland. The acinus may contain crystals, pink secretions or
mucus. It can be seen that perineural invasion, mucinous fibroplasia,
glomerulations.
* Primary urothelial carcinoma: the vast majority are high grade
and are associated with an in situ components. A single cell pattern of
pagetoids spreads or burrowing of tumor cells between the basal cell and
secretary cell layers of the prostate is characteristic. With extensive
tumor involvements, urothelial carcinoma fills and expands ducts and
often develops central comedonecrosis. Stromal invasion is associated
with a prominent desmoplastic stromal response with tumor cells
arranged in small irregular nests, cords and single cells.
* Squamous cell carcinoma: it is identical to squamous cell
carcinoma of other origin.
Adenosquamous carcinoma is defined by the presence of both
glandular (acinar) and squamous cell carcinoma components.
* Basal cell carcinoma: the tumors comprising large basaloid
nests with peripheral palisading and necrosis. Histologic criteria for
malignancy that distinguish it from basal cell hyperplasia an


4
infiltrative pattern, extraprostatic extension, perineural invasion,
necrosis and stromal desmoplasia.
1.2.2. Prostatic intraepithelial neoplasia of the prostate (PIN)
PIN is best characterized as a neoplastic transformation of the
lining epithelium of prostatic ducts and acini. High grade PIN (HGPIN)
is characterized by a more uniform morphologic alteration, The acini
and ducts are lined malignant cells with a variety of architectural
complexity and pattern. The individual cells are almost uniformly
enlarged with increased nuclear/cytoplastic ratio. Therefore showing less
variation in nuclear size than that seen in low grade PIN.
1.2.3. Gleason grading system
Gleason grading system defines five histological patterns with
decreasing differentiation.
Gleason pattern 1, 2, 3, 4, 5. Pca has a pronounced
morphological heterogeneity and usually more than one histological
pattern is present. The primary and secondary pattern, i.e. the most
prevalent the second most prevalent pattern are added to obtained a
Gleason scores.
1.4. Immunohistochemistry in prostate carcinoma
Immunohistochemistry is a special staining technique that uses
specific antibodies to determine the presence of corresponding
antigens on tissue sections or on cell types present in tissue.
Application of Immunohistochemistry to Pca is aimed at:
helping to identify the origin of the tumor, identifying the type of
histopathology, identifying the variants of adenocarcinoma, Gleason
grading, distinguishing malignant lesions from benign lesions,
identify the invasion and metastasis of cancer.
In this study, we performed immunohistochemical staining
with monoclonal antibodies against PSA, CK34βE12, p63, CK5/6,
CK7, actin.
1.5. DNA methylation in cancer
1.5.1. DNA methylation in prostate cancer
DNA methylation is an epigenetic mechanism that occurs by
the addition of a methyl (-CH 3) group to DNA. In human genome,


5
DNA methylation process is the covalent addition of the methyl
group at the 5-carbon of the cytosine ring resulting in 5methylcytosine (5-mC). In prostate cancer, RASSF1A tumor
suppressor gene is often methylated. Methylation-specific PCR (MSPCR or MSP) is one of the most commonly used methods for
gene/sequence-specific detection of DNA methylation. In this study,
RASSF1A gene methylation was selected to analysis DNA
methylation in prostate adenocarcinoma.
1.5.2. Methylation specific PCR
Principles: The DNA undergoes bisulfite conversion of cytosine
to uracil and then the methylated sequences are selectively amplified
with primers specific for methylation.
.
Chapter 2. OBJECTIVES AND RESEARCH METHODS
2.1. Objects
2.1.1. The group of patients for histopathological research
84 specimens of prostate carcinoma (84 patients) performed
transurethral resection of the prostate (TURP) at Military Hospital
103 (from June 2008 to July 2017) that were diagnosed as primary
carcinoma. Patients who have medical records; reports for
histopathology; paraffin imbedded tissue samples are adequate to
analysis.
Exclusion criteria:
Secondary Pca and cases do not meet the need of criteria
which mention above.
2.1.2. The group of patients for immunohistochemistry research
+ 31 tissue samples of primary prostate carcinomas.
+ 2 tissue samples of primary urothelial carcinomas
- Samples of cancer are adequate to carry out an
immunohistochemical staning and still have antigenicity.
- Immunohistochemical staining with monoclonal antibodies
against PSA; CK34βE12; p63; CK5/6; CK7; actin.
2.1.3. The group of patients for RASSF1A methylation research


6
- 20 tissue samples of adenocarcinoma were identified by
histopathology.
- 10 tissue samples of benign hyperplasia of the prostate
(BHP) were identified by histopathology
(in order to compare RASSF1A methylation rate in cancer
with BHP)
- Tissue samples of adenocarcinoma and BHP are sufficient
for DNA methylation assay.
2.2. Research methods
2.2.1. Research design
- Prospective study
- Sampling method: full and intentional sampling.
- Sample size: Calculated according to a ratio survey

With α = 5%; Z1-/2 = 1.96; d = 0.1; p = 78%. Filled in the
above formula, sample size is 66 samples. In fact, prostate cancer
specimens obtained from TURP are usually small, and insufficience
of quantification for many techniques. We have collected 84 samples.
2.2.2. Materials, chemicals, research equipment
2.2.2.1. Information gathering materials
+ Medical records and reports of histopathology of the
Histopathology Department – Military Hospital 103.
+ Collecting informations including: histopathological types;
forms; variants of prostate carcinoma. Differentiation of the tumor is
calculated by the Gleason grading system including Gleason pattern
1, 2, 3, 4, 5. The most prevalent pattern and secondary most prevalent
pattern are added to obtain a Gleason score.
+ Malignant specific features, intraluminal features and
adenocarcinomas associated with HGPIN were as follows: have or
have no. Staining intensity of tumor cells were as follows: “faint”
(1+); “moderate” (2+); “strong” (3+); “very strong” (4+).


7
Methylation of the RASSF1A gene was as follows: unmethylated (-),
methylated (+).
+ All the H.E staining specimens (84 patients) and
immunohistochemical staining specimens (33 patients) were
examined on optical microscope with Nguyen Manh Hung and Tran
Ngoc Dung (Department of Histopathology of Military Hospital 103)
with illustrated photos.
+ Methylation assay: 20 adenocarcinomas samples and 10
BHP samples were analyzed together with Vo Thi Thuong Lan
(Hanoi University of Sciences).
2.2.2.2. Tissue samples of Pca which obtained from TURP
Fragments were randomly submitted to the study.
2.2.2.3. Tissue sections were studied by using for H.E staining,
immunohistochemical staining and methylation assay
- Fixation of the the tissue samples in a 10% neutral buffered
formaldehyde solution, then embedded in paraffin blocks. Trimmed
paraffin blocks are cut at 3-10 micrometers (5 micrometers is
commomly used) to make the H.E stain and immunohistochemical stain.
- Tissue sections of 84 samples prostate carcinoma were stained for
H.E to histopathological analysis; Tissue sections of 33 samples prostate
carcinoma were stained for antibodies against PSA, CK34βE12, p63,
CK5/6, CK7 and actin to immunohistochemical analysis.
- Number of samples for methylation analysis: 20 samples of
prostatic adenocarcinoma and 10 samples of BHP.
2.2.3. Techniques used in research
2.2.3.1. H.E staning technique
- H.E. stain was performed according to routine histological
technique.
- The use of histopathological criteria and the 2004 WHO
classification of tumors of the prostate.
- Use the Olympus CX21 optical microscope.
2.2.3.2. Immunohistochemical technique
+ Chemicals, antibodies, buffer solution, detection system
(Leica, USA).


8
+ Evaluation of results according to McNeal et al. (1991).
2.2.3.3. Determine gene methylation status of RASSF1A
+ Some steps of the MSP technique
- DNA extraction from paraffin-embedded specimens. The
quality DNA of specimens were tested by Polymerase Chain
Reaction (PCR) targeting house keeping gene, β-globin; evaluation
PCR product by electrophoresis on 1.5% agarose gel.
- Bisulfite conversion: The extracted DNA is treated with
bisulfite and purified by Epitect Kit (Qiagen, Cat, No 59104).
- Examination of genomic DNA before and after bisulfite
treatment by PCR, amplifying β-globin gene . The PCR product was
separated on a 1.5% agarose gel in order to test the ability of DNA
treated with bisulfite.
- MSP was performed with specific PCR primers to detect the
methylation of the RASSF1A gene. RASSF1A-M210-F/RASSF1AM211-R primer amplify methylated DNA-specific product (170 bp).
Whereas, nested PCR was performed with RASSF1A-UnF1/RASF1A-Un-R1
and
RASSF1A-Un-F2/RASSF1A-Un-R2
primers (Table 2.3) in order to amplify unmethylated DNA-specific
product.
Table 2.3. Primer sequences for PCR and MSP
Primers
GL-F
GL-R
RASSF1A-M210-F
RASSF1A-M211-R
RASSF1A-Un-F1
RASF1A-Un-R1
RASSF1A-Un-F2
RASF1A-Un-R2

Sequneces (5’3’)
CAACTTCATCCACGTTCACC
GAAGAGCCAAGGACAGGTAC
GGGTTTTGCGAGAGCGCG
GCTAACAAACGCGAACCG
GGGGTTTTGTGAGAGTGTGTTTAG
TAAACACTAACAAACACAAACC
GAGAGTGTGTTTAGTTTTGTTTTTG
CCACAAAACAAACCCCAACTTCAA

2.3. Data analysis: Data is processed by SPSS13 software.


9
2.4. Ethical issues in research: The ethical principles in
research are guaranteed.
Chapter 3. RESEARCH RESULTS
3.1. Proportion of patients with prostate carcinoma by age group
The proportion of patients with prostate carcinoma was highest
in the 70-79 age group (42.86%); average age: 74.34 ± 9.27; no
patients under the age of 40 years seen.
3.2. The results identify some histopathological features of
prostate carcinoma
3.2.1. Determine the types of prostate carcinoma according to the
2004 WHO histological classification of tumors of the prostate
Table 3.2. Types of histopathology
Types of histopathology
Number (n = 84)
Ratio (%)
1. Adenocarcinoma
82/84
97,6
Acinar adenocarcinoma
80/82
97,6
Ductal adenocarcinoma
2/82
2,4
2. Urothelial carcinoma
2/84
2,4
3. Squamous cell carcinoma
0
0
4. Basal cell carcinoma
0
0
3.2.3. Ratio of adenocarcinoma associated with HGPIN
Table 3.4. Association between adenocarcinoma and HGPIN
Histopathology

Number Ratio
p
(n=82)
(%)
Adenocarcinoma associated with HGPIN
60
73,2
Adenocarcinoma without associated with
22
26,8 < 0,001
HGPIN


10
The difference between adenocarcinoma associated with
HGPIN and without associated with HGPN was statistically
significant (p <0.001).
3.2.4. Grouping Gleason score into differentiation categories
Table 3.5. Grouping Gleason score into differentiation categories
Differentiated grade
Gleason
No. of patients Ratio (%)
score
(n=82)
Well differenciated
2–4
14
17,1
Morderately
5-7
58
70,7
differenciated
8 – 10
10
12,2
Poorly differenciated
3.2.7. Distribution of malignant specific features of tumors
Table 3.8. Distributied ratio of adenocarcinoma according to
malignant specific features (n=82)
Malignant specific features

Number

Ratio (%)

Perineural invasion
32
39%
Mucinous fibroplasias
9
11%
Glomerulation
10
12,2%
Tumor has 2 or 3 malignant specific
6
7,3%
No malignant specific features seen
25
30,5%
Table 3.10. The distribution of tumors have malignant specific
features and tumors have no malignant specific features by Gleason
score group
Gleason score
Malignant
specific features
Have
Have no
Total

Gleason 2-4
n=14 (%)

Gleason 5-7 Gleason 8-10
n=58 (%)
n=10 (%)

Total
(%)

1/14 (7,2%) 47/58 (81%) 9/10 (90%) 57 (69,5%)
13/14 (92,8%) 11/58 (19%) 1/10 (10%) 25 (30,5%)
14 (100%)
58 (100%) 10 (100%) 82 (100%)


11
P

< 0.001

There is a correlation between Gleason score and malignant
specific features. The higher the Gleason score, the higher the
incidence of malignant specific features, with p <0.001.
3.2.9. Proportion of substances contained in malignant glands
Table 3.11. Rate of substances contained in malignant glands
Intraluminal features

Number

Ratio (%)

(n=82)
Crystalloids
8
9,7
Pink acellular dense secretions
44
53,7
Crystalloids/Pink acellular dense secretions
18
22
No Crystalloids/Pink acellular dense seen
12
14,6
Table 3.12. Percentage distribution of tumors contain
Crystalloids/Pink acellular dense secretions and tumors no contain
Crystalloids/Pink acellular dense secretions according to the Gleason
score group
Gleason score
Gleason 2-4
n=14 (%)

Gleason 5-7
n=58 (%)

Gleason 8-10
n=10 (%)

Total
Crystalloids
& Pink dense
secretions
Contain
14/14 (100%) 55/58 (94,83%) 1/10 (10%) 70 (85,4%)
No contain
0/14 (0%) 3/58 (5,17%) 9/10 (90%) 12 (14,6%)
Total
14 (100%)
58 (100%)
10 (100%) 82 (100%)
p
< 0,001
There is an association between Gleason score and Crystalloids
& Pink acellular dense secretions. The higher the Gleason score, the
lower the incidence of tumors contain Crystalloids & Pink acellular
dense secretions (p <0.001).
3.3. Results of immunohistochemistry study


12
3.3.1. Immunohistochemical staining of prostate carcinoma
94% of prostate carcinoma express PSA, the remaining 6% of
prostate carcinoma does not express PSA but express CK34βE12 and
p63 (2 cases of urothelial carcinoma). The tumor cells do not express
CK7, CK5/6, actin.
3.3.3. Level of PSA expression of tumor cells
Table 3.16. Level of PSA expression of tumor cells
Histopathology

Acinar
adenocarcinoma
(n=29)

Ductal
adenocarcinoma (n=2)

(-)

0 (0%)

0/2

(1+)

7 (24,2%)

0/2

(2+)
(3+)
(4+)

13 (44,8%)
9 (31%)
0 (0%)

2/2
0/2
0/2

Level
Level

3.3.4. Distribution of PSA expression levels of tumor cells
according to Gleason grade
Table 3.17. PSA expression levels according to
Gleason grade (n = 31)
Gleason
score
vel

Grade Grade Grade Grade
2
3
4
5
Le

(1+)
(2+)
(3+)
(4+)

5
15
9

2

Total
(%)

p

7 (22,6%)
15
(48,4%) < 0,001
9 (29%)
0 (0%)

There is an inverse relation between PSA and Gleason grade. The
higher the Gleason grade, the lower the PSA expression (p <0,001).


13
3.3.5. The level of PSA expression in the tumor group of neural
invasion
- Tumor cells expressed PSA at an average level of 53.85%.
- Tumor cells expressed PSA at an weak level accounts for 46.15%.

3.3.6. Expression of CK34βE12 and p63 of the basal cell
Table 3.19. Expression of 34βE12 and p63 of basal cell
Histopathology
Markers (n=33)
34βE12
p63
Adenocarcinoma Benign part
(+)
(+)
31
31
Cancer part
(-)
(-)
Urothelial cancer Benign part
Cancer part

2

(+)
(+)

2

(+)
(+)

- Adenocarcinoma: benign part expressed CK34βE12 and p63,
whereas the cancer part did not express CK34βE12 and p63.
- Urothelial carcinoma: benign part and cancer part expressed
CK34βE12 and p63.
3.3.8. Status and level of CK7 and CK5/6 expression of benign and
malignant urothelial cell
Table 3.21. Status and level of CK7 and CK5/6 expession of
benign and malignant urothelial cells
Markers (n=33)
Histopathology
CK7
CK5/6
Adenocarcinoma Benign part
(4 +)
(-)
31
31
Cancer part
(-)
(-)
Urinary cancer
Benign part
(4+)
(-)
2
2
Cancer part
(-)
(-)


14
- Adenocarcinoma: benign part expressed CK7, but did not express
CK5/6. The cancer part did not express CK7 and CK5/6.
- Urothelial carcinoma: benign part expressed CK7, but did not
express CK5/6. The cancer part did not express CK7 and CK5/6.
3.3.9. Status and level of actin expression of various stromal types
- The mooth muscle of the prostate gland and vascula expressed actin.
- Fibrous cells, basal cells, endothelial cells did not express actin.
3.4. Results of RASSF1A methylation study
3.4.2. Results of evaluating the efficiency of bisulfite treatment
Results of genomic DNA before and after bisulfite treatment,
amplifying β-globin gene by PCR was indicated in Figure 3.2

Figure 3.2. PCR products amplified the β-globin gene from the
before (red band) and after DNA (yellow band) treated with bisulfite
of the PCa and BHP samples.
Prior to bisulfite treatment, samples were amplified PCR product
(250 bp). After treatment with bisulfite, PCR product was not
obserbed in gel eletrophoresis. Thus, genomic DNA were completely
treated with bisulfite.
3.4.3. Result of RASSF1A methylation in prostate cancer
Methylated and Unmethylated DNA-specific products was
detected in 11/20 (170 bp) and 20/20 (137 bp) Pca samples,


15
respectively. RASSF1A methylation ratio in prostate cancer is 11/20
specimens (55.0%)

Figure 3.1. MSP product of PCa samples (P1-P20) using methylated
primer (RASSF1A-M210-F/RASSF1A-M211-R) and unmethylated
primer (RASSF1A-Un-F2/ RASSF1A-Un-R2)
3.4.4. Result of RASSF1A methylation in begnin hyperplasia of
prostate

Figure 3.4. MSP result of BHP samples (B1-B10)
Note: (m): methylated DNA, (u): unmethylated DNA. (-): negative
control without DNA template
MSP analysis also revealed that the methylation of RASSF1A
was detected in 2/10 patients with BHP. Methylated and


16
unmethylated DNA-specific products was detected in 2/10 (170 bp)
and 10/10 (137 bp) BHP samples, respectively.
3.4.5. Relationship between RASSF1A methylation
and pathological characteristics in prostate cancer
and begnin hyperplasia of prostate
3.4.5.1. RASSF1A methylation in Pca and BHP
Table 3.13. RASSF1A methylation ratio in PCa and BHP
Sample

Number (n=30)

Methylation (%)

PCa

20

11/20 (55%)

BHP

10

2/10 (20%)

Methylation of RASSF1A was detected in 55% and 20% patients
with prostate cancer and begnin hyperplasia of prostate, respectively.
3.4.5.3. Methylation of RASSF1A methylation according to Gleason
score/tumor differentiation
Bảng 3.25. Ratio of RASSF1A methylation according to Gleason
score/ differentiation of tumor
Gleason score

differentiation

Number
(n=20)

Methylation
(%)

Well 7
2 (28,6%)
differentiated
Moderately
5-7
8
4 (50%)
differentiated
poorly8-10
5
5 (100%)
differentiated
RASSF1 methylation increased according to Gleason score
2-4

differentiation of tumor.


17
3.4.5.4. Methylation of the RASSF1A gene and status of neural
invasion


18
Table 3.26. Methylation ratio according to status of neural invasion
Neural invasion

Total

Methylation rate (n %)

(n=20)
Have

7

6/7 (85,7%)

No

13

5/13 (38,5%)

The rate of methylation in tumor groups of neural invasion is high
(85.7%).
3.4.5.5. Methylation of RASSF1A gene and PIN status in BHP
Table 3.27. RASSF1A gene methylation rate and PIN status in BHP
Total

Methylation rate

(n=10)

(n %)

BHP associated with low PIN

5

2/5 (40%)

BHP without associated with low PIN

5

0/5 (0%)

Histopathology

The methylation rate in BHP group associated with low PIN of 40%.
No methylation was detected in the BHP group with have no PIN.
Chapter 4. DISCUSSION
4.1. Percentage of patients with prostate cancer by age group
Proportion of patients with Pca increased with age group: group 7079 accounts for the highest rate (42.86%), group 40-49 accounts for
very low rate (1.19%). Our result is consistent with Nguyen Viet Hai
(2013), Ngo Van Trung (2004) and Gronberg H. (2003).
4.2. Some histopathological features of prostate carcinoma
4.2.1. Identify the histopathology types, forms, and variants


19
+ 2 out of 4 types of primary carcinomas were identified that were
adenocarcinoma and urothelial carcinoma. No squamous cell
carcinoma and basal cell carcinoma to be found.
+ Our result shows that primary adenocarcinoma accounts for 97.6%.
This result is higher than Nguyen Van Hung (2004) but that is
equivalent to the result of Nguyen Viet Hai (2013). Detection of
primary urothelial carcinoma accounts for 2.4%. This result is
consistent with Eble.J.N (2004) and Mostofi (1992).
+ Acinar adenocarcinoma accounts for 97.6%. This result is higher
than Nguyen Van Hung (2004) and in accordance with previous
announcements. Ductal adenocarcinoma accounts for 2.4%, which is
a rare form. This result is consistent with published reports.
+ Ordinary acinar adenocarcinoma variant is the most frequent
(87.5%), following pseudo-hyperplastic variant (7.5%) and atrophic
variant (5%). Variant such as foamy gland, ring cells, colloid,
oncocytic cell, lymphoepithelioma-like cell and carcinosarcoma were
undetected. This result matches Eble J.N ‘s announcement (2004).
4.2.2. Adenocarcinoma associated with HGPIN
+ The incidence of adenocarcinoma associated with HGPIN is
73.2%. This result is in accordance with Nguyen Van Hung (2005)
and Alexander E. E. (1996).
+ Adenocarcinoma associated with HGPIN accounted for the highest
proportion in the Gleason score group 5-7 (66.7%), group 2-4 and
group 8-10 were low proportion. This result was partially matched
with authors such as Eptain JL. Erbersdobler A. (1996), Hagman M.
J. (1997), Montoroni R. (1999), Paradis V. (1999).
4.2.3. Gleason grades in adenocarcinoma
+ Gleason grade 3 usually meets in the primary patterns (46.3%),
Gleason grade 4 is usually meets in the second patterns (43.9%), the


20
remaining Gleason grades account for low proportion. This result is
in accordance with Nguyen Van Hung (2005) and Samaratunga H.
(2014). Eble. J. N (2004).
+ Gleason score of 5-7 was the highest (70.7%), this is consistent
with Sgrignoli A. (1994), Samaratunga H. (2014). Gleason score 2-4
was 17.1%, that was higher than Nguyen Van Hung (2005) and
Oesterling (1987).
+ Gleason score 8-10 was 12.2%, that was lower than Nguyen Viet
Hai (2013) and Nguyen Van Hung (2005). In our opinion, this
difference is due to the selection of subjects.
4.2.4. Malignant specific features
+ Malignant characteristics of tumors were 69.5%, tumors had no
malignant characteristics were 30.5% (p <0.001).
+ The incidence of neural invasion tumor was 39%, this is lower than
Eble's. J. N (2004). In our opinion, this result may be due to the
selection of subjects.
+ The incidence of mucinous fibroplasia was 11%, and we found
only in Gleason score 5-7 and 8-10. This result was consistent with
Christian J. D. (2005).
+ Glomerulation like-malignant glands were 12.2%, and we found
only in Gleason score 5-7 and Gleason score 8-10.
4.2.5. Luminal features
+ Tumors containing luminal features (85.4%) were higher than
tumors non-containing luminal features (p <0.001).
+ Tumors containing eosinophilic crystals (9.7%) were consistent
with Young (2000) but higher than Nguyen Van Hung (2005).
+ Tumors containing dense pink secretions (53.7%), in accordance
with Iczkowski K. A. (1999) and Christian J. D. (2005).


21
+ Tumors containing dense pink secretions/crystals (22%). Tumors
do not contain dense pink secretions /crystals (14.6%).
4.3. The expression of some immunological markers and the
methylation status of the RASSF1A gene in carcinoma of the prostate.
4.3.1. Expression of some immunological markers.
* Prostate specific antigen (PSA)
Primary carcinoma expresses PSA (94%), this result matched
Nguyen Van Hung (2005) and Brimo F. (2012).
Gleason grade 4 and 5 express PSA at week level, Gleason grade 3
expresses PSA at the moderate level, Gleason grade 2 expresses PSA
at strong level. The higher the Gleason score (less differentiation), the
less likely the expression (p <0.001). This result is consistent with the
notice in the literature.
Primary urothelial carcinoma does not express PSA, consistent with
Eble.J.N. (2004) and previous studies.
Tumors with neural invasion expresses PSA at the weak level
(46.2%) and at the moderate level (53.8%). This result is consistent
with Epstein J. I. (2014) and previous studies.
* High molecular weight cytokeratins detected by CK34βE12
Malignant gland part does not exposed CK34βE12, in accordance
with the published reports.
+ Benign gland part expresses CK34βE12 from moderate level
(69.7%) to strong level (30.3%), partly consistent with the results of
researching of Nguyen Van Hung (2005).
* p63
+ Malignant gland part does not express p63.
+ Benign gland part and urothelial carcinoma express p63.
Primary urothelial carcinoma: remnant basal cells of urothelial
carcinoma in situ express CK34βE12 and p63.


22
+ Basal cells express p63 at the strong level (81.8%) and moderate
level (18.2%). This matched previously reports.
* Cytokeratin 7
The benign urothelial cells express CK7 at very high levels (100%
cases). Meanwhile, primary urothelial carcinoma does not express
CK7. This result is similar to Nguyen Van Hung ‘s result (2005). The
use of CK7 will contribute to differentiating primary urothelial
carcinoma of the prostate with secondary urothelial carcinoma and
other types of carcinoma.
* Cytokeratin 5/6
Benign prostatic epithelium, benign urothelial epithelium and
malignant urothelial epithelium do not express CK5/6. This result
consistent with published reports. Thus, the use of CK5/6 will help to
identify the primary squamous cell carcinoma of the prostate with
secondary squamous cell carcinoma.
* Actin
The smooth muscle of the prostate and the smooth muscle of the
blood vessels express actin at a very high level. Basal cells,
fibrocytes, endothelial cells do not express actin. This result is
consistent with published reports. The use of actin will determine the
invasion of tumor cells to wall of blood vessels.
4.4.2. Status of RASSF1A gene methylation in adenocarcinoma and
begnin hyperplasia of prostate
+ Ratio of RASSF1A gene methylation in adenocarcinoma (55%) was
higher in begnin hyperplasia of prostate (20%).
+ Ratio of RASSF1A methylation in adenocarcinoma of this study is
consistent with some reports such as Bastian PJ (2004), Singal
(2004), whereas ratio of RASSF1A methylation is lower than one in


23
reports of Woodson (2004), Kuzmin (2004), Liu L. (2002),
Kawamoto (2007).
+ Ratio of RASSF1A methylation in adenocarcinoma of this study is
higher than ratio of RASSF1A methylation in analysis of Syeed N.
(2010), Võ Thị Thương Lan (2016).
+ Ratio of RASSF1A methylation in Gleason grade based group
including grade 2, grade 3 and 4, grade 5 is 25%, 66.6% and 100%,
respectively. Ratio of RASSF1A methylation increases according to
Gleason score. Ratio of RASSF1 methylation in Well – differentiated
group (Gleason score 2-4), Moderately differentiated group (Gleason
score 5-7) and poorly- differentiated group (Gleason score 8-10) is
28.6%, 50% and 100%, respectively. This result is partly consistent
with report of Lui L. (2002).
The methylation rate of neural invasive tumor group (85.7%) is
higher than those without neural invasive tumor group (38.5%), this
result is consistent with the result of Kang (2004).
+ RASSF1A methylation in begnin hyperplasia of prostate:
The RASSF1A methylation rate in begnin hyperplasia of prostate is
20%. This result is consistent with reports of Singal (2004),
Kawamoto K. (2007), Syeed N. (2010) and Vo Thi Thuong Lan
(2016).


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×