Tải bản đầy đủ

Nghiên cứu đặc điểm mô bệnh học, hóa mô miễn dịch và tình trạng methyl hóa gen RASSF1A trong ung thư biểu mô tuyến tiền liệt tom tat luan an (tieng viet)

1
BỘ GIÁO DỤC VÀ ĐÀO TẠO

BỘ QUỐC PHÒNG

HỌC VIỆN QUÂN Y
=== *** ===

VI THUẬT THẮNG

NGHIÊN CỨU ĐẶC ĐIỂM MÔ BỆNH HỌC, HÓA MÔ MIỄN
DỊCH VÀ TÌNH TRẠNG METHYL HÓA GEN RASSF1A
TRONG UNG THƯ BIỂU MÔ TUYẾN TIỀN LIỆT
Chuyên ngành: Khoa học y sinh
Mã số:

9720101

TÓM TẮT LUẬN ÁN TIẾN SĨ Y HỌC

Hà Nội - 2018



2
Công trình được hoàn thành tại: Học viện Quân y.

Người hướng dẫn khoa học:

1. GS.TS. Nguyễn Đình Tảo
2. TS. Nguyễn Ngọc Hùng

Phản biện 1: PGS. TS. Nguyễn Văn Hưng
Phản biện 2: PGS.TS. Quản Hoàng Lâm
Phản biện 3: PGS.TS. Trịnh Tuấn Dũng

Luận án sẽ được bảo vệ trước Hội đồng chấm luận án cấp Trường
Họp tại vào hồi......... giờ........ngày.......tháng.......năm 2018

Có thể tìm hiểu luận án tại các thư viện:
- Thư viện Quốc gia
- Thư viện Học viện Quân y


3
CÁC CÔNG TRÌNH KHOA HỌC
CÓ LIÊN QUAN ĐẾN LUẬN ÁN
1.

Vi Thuật Thắng, Nguyễn Đình Tảo, Võ Thị Thương Lan và
cs (2014), “Nghiên cứu hiện tượng tăng methyl hóa của gen
RASSF1A trong ung thư tuyến tiền liệt tại Bệnh viện 103”, Tạp
chí Y dược lâm sàng 108., (9): 77-81.

2.

Vi Thuat Thang, Nguyen Đinh Tao, Nguyen Ngoc Hung et
al. (2017),

“ Study on some histopathological features and

expression of some immunohistochemical markers in prostatic


carcinoma”, Journal of Military Pharmaco - Medicine., (8): 222227.


4

GIỚI THIỆU LUẬN ÁN
1. Đặt vấn đề
Ung thư tuyến tiền liệt (UTTTL) thường gặp ở người trên 65
tuổi, bệnh diễn biến thầm lặng. Phần lớn các trường hợp được phát
hiện tình cờ qua xét nghiệm (XN) mô bệnh học (MBH). Ở Việt Nam,
tỷ lệ UTTTL được phát hiện qua xét nghiệm MBH sau phẫu thuật
tăng sản tuyến tiền liệt (TTL) khoảng 8%, tỷ lệ mắc chuẩn theo tuổi
năm 2012 là 3,4/100.000 dân và xếp hàng thứ 10 về ung thư (UT) ở
nam giới. UTTTL có thể được điều trị hiệu quả nếu bệnh được phát
hiện ở giai đoạn sớm. Vì vậy, việc tìm ra phương pháp phát hiện và
chẩn đoán sớm, đồng thời đánh giá đúng mức độ tổn thương thì việc
áp dụng một tiêu chuẩn và một bảng phân loại thống nhất là rất cần
thiết để đưa ra phương pháp điều trị thích hợp và tiên lượng căn bệnh
này.
Trên thế giới, nhiều nghiên cứu (NC) chỉ ra sự methyl hóa gen
Ras – association domain family 1 isoform A (RASSF1A) xảy ra vào
giai đoạn sớm của quá trình hình thành và tiến triển của UTTTL, do
đó việc áp dụng dấu chuẩn methyl hóa gen RASSF1A trong UTTTL
đang được quan tâm. Ở Việt Nam, các NC về methyl hóa ADN liên
quan đến UT mới được triển khai, các NC về MBH, hóa mô miễn
dịch (HMMD) chưa nhiều và chưa có NC đầy đủ nào về đặc điểm


5
MBH ung thư biểu mô tuyến tiền liệt (UTBM TTL) theo phân loại
của Tổ chức Y tế Thế giới (WHO) năm 2004 kết hợp với xác định sự
bộc một số dấu ấn miễn dịch và tình trạng methyl hóa gen RASSF1A
trong UTBM TTL. Trên cơ sở đó, chúng tôi thực hiện đề tài với mục
tiêu:
a. Nghiên cứu một số đặc điểm mô bệnh học ung thư biểu mô tuyến
tiền liệt tại Bệnh viện Quân y 103 theo phân loại của WHO (2004).
b. Xác định sự bộc lộ một số dấu ấn miễn dịch, tình trạng methyl
hóa gen RASSF1A và đối chiếu với một số đặc điểm mô bệnh học
trong ung thư biểu mô tuyến tiền liệt.
2. Những đóng góp mới của luận án
+ Nghiên cứu tình trạng methyl hóa gen RASSF1A trong một số
trường hợp ung thư biểu mô tuyến tiền liệt.
+ Đối chiếu tình trạng methyl hóa gen RASSF1A với một số đặc điểm
mô bệnh học trong ung thư biểu mô tuyến tiền liệt.
+ Áp dụng đồng thời các dấu ấn PSA, CK34beta12, p63, CK5/6,
CK7 và actin để hỗ trợ chẩn đoán, xác định típ, phân độ mô học ung
thư biểu mô tuyến tiền liệt.
3. Cấu trúc của luận án
Luận án dài 135 trang gồm: Đặt vấn đề (2 trang); Chương 1- Tổng
quan tài liệu: 40 trang; Chương 2- Đối tượng và phương pháp nghiên
cứu: 20 trang; Chương 3- Kết quả nghiên cứu: 31 trang; Chương 4Bàn luận: 40 trang; Kết luận: 2 trang; Kiến nghị: 1 trang; Danh sách
bài báo: 1 trang; Luận án có 27 bảng số liệu; 1 sơ đồ; 13 hình; 25 ảnh;
148 tài liệu tham khảo (25 tiếng Việt, 123 tiếng Anh); Phụ lục mẫu
phiếu nghiên cứu và Danh sách bệnh nhân.
Chương 1. TỔNG QUAN TÀI LIỆU
1.1. Sơ lược về mô học và phân loại ung thư tuyến tiền liệt
1.1.1. Mô học
Tuyến tiền liệt gồm các nang tuyến, ống tuyến phân nhánh, ống dẫn
chính và niệu đạo TTL. Các nang tuyến và ống tuyến được lót bởi một


6
lớp tế bào (TB) chế tiết ở bên trong và một lớp TB đáy ở bên ngoài.
TTL không có lớp cơ biểu mô, các nang/ống tuyến được bao quanh bởi
các TB cơ trơn, nguyên bào sợi và sợi collagen. Lòng các nang/ống
tuyến chứa chất tiết và các thể amylacea. Các ống dẫn chính được lót
biểu mô (BM) chuyển tiếp.
1.1.2. Phân loại mô bệnh học UTBM TTL theo WHO (2004)
UTBM TTL gồm 4 típ: UTBM tuyến, UTBM đường niệu,
UTBM tế bào vảy, UTBM tế bào đáy. UTBM tuyến gồm thể tuyến
nang và thể tuyến ống.
1.2. Ung thư biểu mô tuyến tiền liệt, tân sản nội biểu mô và phân
độ Gleason
1.2.1. Ung thư biểu mô tuyến tiền liệt
* Ung thư biểu mô tuyến: u gồm các nang/ống tuyến sắp xếp
hỗn độn hoặc rời rạc, tuyến cấu trúc dạng mặt sàng, các tuyến hòa
nhập vào nhau hoặc u gồm các đám, các dải TB. Nhân TB lớn, tăng
sắc, hạt nhân to, rải rác có hình nhân chia, có thể thấy nhân đa hình
thái. Bào tương TB sáng hơn TB tuyến lành tính. Lòng tuyến nang có
thể chứa tinh thể, chất tiết màu hồng hoặc/chất dạng mucin màu xanh
nhạt. Có thể thấy u xâm lấn dây TK, u tăng sinh xơ- nhày, tuyến UT
giống tiểu cầu thận.
* UTBM đường niệu nguyên phát: hầu hết là UTBM đường niệu
kém biệt hóa kết hợp với UTBM đường niệu tại chỗ. Trong đó, có
một hình ảnh đặc trưng, đó là: TB u giống TB Paget nằm giữa lớp TB
đáy và TB chế tiết. Khi TB u lan vào ống dẫn, các ống dẫn lấp đầy
TB u và thường có hoại tử dạng trứng cá. Khi TB u xâm lấn vào mô
đệm, phản ứng xơ hóa của mô đệm rất rõ.
* UTBM tế bào vảy: TB ung thư hình đa diện có cầu nối gian
bào và chất keratin. Có thể thấy cấu trúc u gồm các ống tuyến, nhưng


7
một số TB tuyến biệt hóa TB vảy (UTBM tuyến-TB vảy).
* UTBM tế bào đáy: TB u có nhân hình tròn hoặc có góc, chất
nhiễm sắc mịn, bào tương hẹp, sắp xếp song song theo hình cọc
rào, u hay bị hoại tử. Có thể thấy TB u xâm nhập mô đệm và dây
TK.
1.2.2. Tân sản nội biểu mô tuyến tiền liệt
Tân sản nội biểu mô tuyến tiền liệt (prostatic intraepithelial
neoplasia: PIN) là tổn thương tăng sinh TB chế tiết, đi kèm với
những thay đổi về nhân TB như: nhân lớn, chất nhiễm sắc đậm và
phân bố không đều, hạt nhân lớn, màng nhân dày nhưng vẫn còn lớp
TB đáy. Trong PIN độ cao, tính chất không đều của nhân rõ rệt hơn
PIN độ thấp.
1.2.3. Phân độ Gleason
UTBM tuyến được chia thành 5 độ Gleason. Điểm Gleason là
tổng độ Gleason của mẫu chiếm diện tích nhiều nhất (mẫu nguyên
phát) và mẫu chiếm diện tích nhiều thứ nhì (mẫu thứ phát).
1.3. Xâm lấn và di căn
Khối u vùng chuyển tiếp thường xâm lấn về vùng trước của
TTL, u vùng ngoại vi thường xâm lấn ra vùng sau bên. Giai đoạn
muộn, u xâm lấn vào túi tinh, cổ bàng quang. TB u xâm lấn vào mạch
máu và mạch mạch huyết di căn vào hạch limphô vùng, di căn vào
xương chậu, xương cột sống... và các tạng.
1.4. Hoá mô miễn dịch trong ung thư biểu mô tuyến tiền liệt
HMMD là một kỹ thuật nhuộm đặc biệt, sử dụng kháng thể
(KT) đặc hiệu để xác định sự hiện diện của các kháng nguyên (KN)
tương ứng trên các lát cắt mô hoặc trên các loại TB có trong mô.
Nguyên tắc: cho KT đặc hiệu lên mô, nếu trong mô có KN sẽ có phản
ứng kết hợp KN - KT.


8
Ứng dụng HMMD trong UTBM TTL nhằm mục đích trợ giúp
xác định: nguồn gốc khối u; xác định đặc điểm MBH; phân biệt tổn
thương lành tính với ác tính; phân biệt UT xâm lấn và di căn…
Trong NC này chúng tôi nhuộm HMMD với các KT kháng
(PSA, CK34βE12, p63, CK5/6, CK7, actin).
1.5. Methyl hóa ADN trong ung thư tuyến tiền liệt
1.5.1. Methyl hóa ADN: methyl hóa ADN là hiện tượng gắn thêm
gốc methyl vào nucleotide trên phân tử ADN. Ở người, methyl hóa
ADN xảy ra ở cytosine đứng trước guanine trong phức hợp CpG tạo
thành 5-methylcytosine. Trong UTTTL gen ức chế khối u RASSF1A
rất hay bị methyl hóa. Methyl specific PCR (MSP) là một trong
những phương pháp dùng để phát hiện methyl hóa.
Trong NC này, chúng tôi lựa chọn gen RASSF1A để phân tích
dấu chuẩn methyl hóa trong UTBM tuyến của TTL.
1.5.2. Phương pháp MSP phát hiện methyl hóa ADN
Đặc điểm của phương pháp: ADN sau khi xử lý bisulfite có thể
bao gồm ADN bị methyl hóa có CpG được giữ nguyên, ADN không
bị methyl hóa có CpG đều bị biến đổi thành thymine. Kỹ thuật MSP
sử dụng các cặp mồi đặc hiệu thiết kế dựa vào vùng giàu CpG cho
phép phân biệt ADN bị methyl hóa với ADN không bị methyl hóa.
Chương 2. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng
2.1.1. Nhóm bệnh nhân nghiên cứu đặc điểm mô bệnh học
84 mẫu mô UTBM TTL (84 bệnh nhân) phẫu thuật nội soi qua niệu
đạo tại Bệnh viện Quân y 103 (6/2008 - 7/2017) được chẩn đoán MBH
là UTBM TTL nguyên phát. Các bệnh nhân (BN) có bệnh án, phiếu yêu
cầu XN MBH, khối paraffin lưu giữ mẫu mô đủ để nghiên cứu.


9
Tiêu chuẩn loại trừ:
UTTTL thứ phát, UTTTL đã xạ trị, dùng hóa chất, BN có nhiều
UT cùng lúc, BN không phải là người Việt Nam, UTTTL được phẫu
thuật toàn bộ tuyến và các trường hợp không đủ các tiêu chuẩn trên.
2.1.2. Nhóm bệnh nhân nghiên cứu HMMD
Sau khi đã loại 51 trường hợp không đủ tiêu chuẩn (mẫu mô hết
dần do ưu tiên cắt nhuộm H.E…), còn lại gồm:
+ 31 mẫu mô UTBM tuyến nguyên phát của TTL.
+ 2 mẫu mô UTBM đường niệu nguyên phát của TTL
Nhuộm HMMD với các KT kháng (PSA, CK34βE12, p63, CK5/6,
CK7, actin).
2.1.3. Nhóm bệnh nhân nghiên cứu methyl hóa gen RASSF1A
- 20 mẫu mô UTBM tuyến đủ tiêu chuẩn xét nghiệm methyl hóa.
Do ưu tiên cắt nhuộm H.E và HMMD, mẫu UT hết dần nên không
đảm bảo chất lượng ADN cho MSP, do đó, đã loại 64 trường hợp
không đủ tiêu chuẩn.
- Chọn 10 mẫu mô tăng sản TTL (10 BN) đã được chẩn đoán xác
định bằng MBH để so sánh tỷ lệ methyl hóa gen RASSF1A trong tăng sản
TTL với UTBM tuyến của TTL.
2.2. Phương pháp nghiên cứu
2.2.1. Thiết kế nghiên cứu
- Nghiên cứu tiến cứu, mô tả cắt ngang.
- Phương pháp lấy mẫu: lấy mẫu toàn bộ và có chủ định.
- Cỡ mẫu: tính toán theo công thức điều tra một tỷ lệ:

Với α = 5%; Z1-/2 = 1,96; d = 0,1; p = 78%. Lắp vào công thức
trên, cỡ mẫu NC là 66 mẫu. Thực tế các mảnh bệnh phẩm TTL chứa


10
ổ UT được phẫu thuật nội soi thường là nhỏ, khó đủ lượng để thực
hiện nhiều kỹ thuật. Chúng tôi thu thập 84 mẫu.
2.2.2. Vật liệu, hóa chất, thiết bị nghiên cứu
2.2.2.1. Vật liệu thu thập thông tin
Bệnh án và biên bản hội chẩn tiêu bản kèm theo phiếu trả lời kết
quả MBH của khoa Giải phẫu bệnh - Bệnh viện Quân y 103.
Hội chẩn tiêu bản để thu thập các thông tin bao gồm: típ MBH,
các thể, các biến thể UTBM TTL. Mức độ biệt hóa của khối u được
tính theo hệ thống Gleason: gồm độ 1, 2, 3, 4, 5. Điểm Gleason là
tổng của độ Gleason thuộc vùng có diện tích nhiều nhất và vùng có
diện tích nhiều thứ nhì. Các đặc điểm đặc trưng ác tính, chất chứa
trong tuyến nang UT và UTBM tuyến phối hợp với PIN độ cao được
đánh giá: có hoặc không. Mức độ bộc lộ các dấu ấn MD gồm: không
bộc lộ (-), có bộc lộ (+), bộc lộ yếu (1+), trung bình (2+), mạnh (3+),
rất mạnh (4+). Methyl hóa gen RASSF1A được đánh giá: không bị
methyl hóa (-), bị methyl hóa (+).
- Tất cả tiêu bản nhuộm H.E (84 BN) và nhuộm HMMD (33
BN) đều được hội chẩn trên kính hiển vi quang học cùng với Nguyễn
Mạnh Hùng và Trần Ngọc Dũng (Bộ môn - khoa GPB, Bệnh viện
Quân y 103). Chụp ảnh minh họa từng trường hợp.
- Các mẫu mô TTL xét nghiệm methyl hóa, gồm: 20 mẫu UT và 10
mẫu tăng sản TTL được phân tích, đánh giá KQ cùng với Võ Thị
Thương Lan (Phòng thí nghiệm Sinh Y- Đại học Khoa học Tự nhiên –
ĐHQG Hà Nội).
2.2.2.2. Bệnh phẩm u TTL được phẫu thuật nội soi qua niệu đạo
Lấy 12 gam/trường hợp, nếu bệnh phẩm ít sẽ lấy toàn bộ. Các
mảnh bệnh phẩm đưa vào nghiên cứu một cách ngẫu nhiên.
2.2.2.3. Bệnh phẩm được nghiên cứu kỹ thuật H.E, hóa mô miễn dịch


11
và methyl hóa:
- Cố định bệnh phẩm trong dung dịch formol đệm trung tính
10%, sau đó được đúc trong paraffin, cắt mảnh hàng loạt với độ dày
từ 3 - 4 micromet để làm thành các tiêu bản nhuộm H.E, HMMD và
XN methyl hóa.
- Nhuộm H.E: 84 mẫu; nhuộm HMMD: 33 mẫu, các KT được
sử dụng là KT kháng (PSA, CK34βE12, p63, CK5/6, CK7, actin).
Số trường hợp làm XN methyl hóa: 20 mẫu mô UTBM tuyến
và 10 mẫu mô tăng sản TTL.
2.2.3. Các kỹ thuật dùng trong nghiên cứu
2.2.3.1. Kỹ thuật nhuộm H.E
- Nhuộm H.E được tiến hành theo kỹ thuật mô học thường quy.
- Sử dụng các tiêu chuẩn MBH, bảng phân loại mô khối u TTL
của WHO (2004) để chẩn đoán MBH, xác định típ, các thể, độ
Gleason và đặc điểm mô bệnh học.
- Sử dụng kính hiển vi quang học Olympus CX21.
2.2.3.2. Kỹ thuật hóa mô miễn dịch
+ Hóa chất sử dụng, các kháng thể, dung dịch đệm rửa bộc lộ
kháng nguyên và hệ thống phát hiện của hãng Leica.
+ Cách đánh giá và nhận định kết quả: đánh giá theo tiêu chuẩn
của McNeal và cs (1991).
2.2.3.3. Kỹ thuật xác định tình trạng methyl hóa gen RASSF1A
+ Một số bước của kỹ thuật MSP
- Tách chiết ADN từ mẫu mô đúc trong paraffin, kiểm tra chất
lượng ADN tách chiết bằng PCR với mồi β-globulin, sản phẩm PCR
được kiểm tra bằng diện di trên gel agarose 1,5%.
- Biến đổi bisulfite: ADN tách chiết sẽ được xử lý với bisulfite
và tinh sạch bằng Epitect Kit (Qiagen, Cat, No 59104).


12
- Kiểm tra chất lượng ADN genome trước và sau khi xử lý với
bisulfite bằng phản ứng PCR nhân bản gen β-globulin từ khuôn ADN
trước và sau xử lý với bisulfate. Sản phẩm PCR được diện di trên gel
agarose 1,5% để kiểm tra ADN tổng số đã xử lí hoàn toàn với
bisulfite.
- Thực hiện phản ứng MSP nhằm xác định sự methyl hóa gen
RASSF1A được thực hiện với các cặp mồi đặc hiệu bằng PCR. Sản
phẩm PCR phát hiện methyl hóa bằng cặp mồi đặc hiệu RASSF1AM210-F/RASSF1A-M211-R có kích thước là 170 bp. Để phát hiện
gen RASSF1A có cytosine không bị methyl hóa, phản ứng MSP cũng
được thực hiện với các cặp mồi đặc hiệu bằng nested PCR. Sản phẩm
PCR lần 1 với cặp mồi đặc hiệu RASSF1A-Un-F1/RASF1A-Un-R1
được pha loãng 100 lần và sử dụng làm khuôn cho phản ứng lần 2
với cặp mồi RASSF1A-Un-F2/RASSF1A-Un-R2. (bảng 2.3.)
Bảng 2.3. Trình tự nucleotide các mồi cho phản ứng PCR và MSP
Tên mồi

Trình tự nucleotide (5’>3’)

GL-F
CAACTTCATCCACGTTCACC
GL-R
GAAGAGCCAAGGACAGGTAC
RASSF1A-M210-F
GGGTTTTGCGAGAGCGCG
RASSF1A-M211-R
GCTAACAAACGCGAACCG
RASSF1A-Un-F1
GGGGTTTTGTGAGAGTGTGTTTAG
RASF1A-Un-R1
TAAACACTAACAAACACAAACC
RASSF1A-Un-F2
GAGAGTGTGTTTAGTTTTGTTTTTG
RASF1A-Un-R2
CCACAAAACAAACCCCAACTTCAA
2.3. Xử lý số liệu: Dữ liệu được xử lý bằng phần mềm SPSS13.
2.4. Vấn đề đạo đức trong nghiên cứu: Các nguyên tắc y đức trong
nghiên cứu được đảm bảo.
Chương 3. KẾT QUẢ NGHIÊN CỨU


13
3.1. Phân bố tỷ lệ bệnh nhân mắc UTBM TTL theo nhóm tuổi
Tỷ lệ BN mắc UTBM TTL cao nhất ở nhóm tuổi 70-79
(42,86%); trung bình 74,34 ± 9,27; không gặp tuổi dưới 40.
3.2. Kết quả xác định một số đặc điểm mô bệnh học
3.2.1. Xác định típ MBH UTBM TTL theo WHO (2004)
Bảng 3.2. Xác định típ mô bệnh học
Típ mô bệnh học UTBM
Số lượng (n=84)
Tỷ lệ (%)
1. UTBM tuyến
82/84
97,6
UTBM tuyến nang
80/82
97,6
UTBM tuyến ống
2/82
2,4
2. UTBM đường niệu
2/84
2,4
3. UTBM tế bào vảy
0
0
4. UTBM tế bào đáy
0
0
3.2.3. Tỷ lệ UTBM tuyến phối hợp và không phối hợp với PIN độ cao
Bảng 3.4. UTBM tuyến phối hợp và không phối hợp với PIN độ cao
Mô bệnh học
Số lượng Tỷ lệ
p
(n=82)
(%)
60
73,2
Phối hợp PIN độ cao
< 0,001
22
26,8
Không phối hợp PIN độ cao
Sự khác biệt giữa UTBM tuyến phối hợp với PIN độ cao và UTBM
tuyến không phối hợp với PIN độ cao có ý nghĩa thống kê (p < 0,001).
3.2.4. Tỷ lệ UTBM tuyến theo độ biệt hóa/nhóm điểm Gleason
Bảng 3.5. Tỷ lệ UTBM tuyến theo độ biệt hóa/nhóm điểm Gleason
Độ biệt hóa Điểm Gleason Số lượng (n=82)
Tỷ lệ (%)
Biệt hóa cao
Biệt hóa vừa
Kém biệt hóa

2-4
5-7
8 – 10

14
58
10

17,1
70,7
12,2

3.2.7. Phân bố tỷ lệ các đặc điểm đặc trưng ác tính của u
Bảng 3.8. Tỷ lệ các đặc điểm đặc trưng ác tính của u
Đặc điểm đặc trưng ác tính
Số lượng (n=82) Tỷ lệ (%)


14
U xâm nhập dây TK
U tăng sinh xơ-nhày
Tuyến ung thư giống tiểu cầu thận
U có 2 - 3 đặc điểm đặc trưng ác tính
U không có đặc điểm đặc trưng ác tính

32
9
10
6
25

39%
11%
12,2%
7,3%
30,5%


15
Bảng 3.10. Phân bố tỷ lệ u có đặc điểm đặc trưng ác tính và u không
có đặc điểm ác tính theo nhóm điểm Gleason
Điểm Gleason
Gleason 2-4 Gleason 5-7 Gleason 8-10 Tổng số

Đặc điểm

n=14 (%)

đặc trưng

n=58 (%)

n=10 (%)

(%)

ác tính


1/14 (7,2%) 47/58 (81%) 9/10 (90%) 57 (69,5%)

Không có

13/14 (92,8%) 11/58 (19%) 1/10 (10%) 25 (30,5%)

Tổng số

14 (100%)

Hệ số tương quan
Spearman

58 (100%)

10 (100%) 82 (100%)

rho=0,523; p< 0.001

Có sự liên quan giữa điểm Gleason với đặc điểm đặc trưng ác
tính. Điểm Gleason càng cao thì tỷ lệ u có đặc điểm đặc trưng ác tính
càng nhiều, với p < 0.001.
3.2.9. Phân bố tỷ lệ các chất chứa trong tuyến nang ác tính
Bảng 3.11. Tỷ lệ các chất chứa trong tuyến nang ác tính
Chất chứa trong tuyến nang
Tinh thể
Chất tiết kết đặc màu hồng
Tinh thể/chất tiết kết đặc màu hồng
Không chứa tinh thể/chất tiết kết đặc màu hồng

Số lượng
(n=82)
8
44
18
12

Tỷ lệ (%)
9,7
53,7
22
14,6


16
Bảng 3.13. Phân bố tỷ lệ u chứa tinh thể/chất tiết kết đặc màu hồng
và u không chứa tinh thể/chất tiết kết đặc màu hồng theo
nhóm điểm Gleason
Điểm Gleason
Gleason 2-4
n=14 (%)

Tinh thể
& chất kết
đặc màu hồng
Chứa

Gleason 5-7 Gleason 8-10
Tổng (%)
n=58 (%)
n=10 (%)

14/14 (100%) 55/58 (94,83%) 1/10 (10%) 70 (85,4%)

Không chứa

0/14 (0%)

3/58 (5,17%)

Tổng

14 (100%)

58 (100%)

Spearman

9/10 (90%) 12 (14,6%)
10 (100%)

82 (100%)

rho=-0,681; p< 0,001

Có sự liên quan giữa điểm Gleason và u chứa tinh thể/chất tiết
kết đặc màu hồng. Điểm Gleason càng cao thì tỷ lệ u chứa tinh thê
̉/chất tiết kết đặc màu hồng càng giảm (p < 0.001).
3.3. Kết quả nghiên cứu hóa mô miễn dịch
3.3.1. Kết quả nhuộm hóa mô miễn dịch UTBM TTL
Có 94% UTBM TTL bộc lộ PSA, 6% UTBM TTL không bộc lộ
PSA (2 trường hợp UTBM đường niệu). Có 6% u bộc lộ CK34βE12,
6% u bộc lộ p63. Không có trường hợp nào u bộc lộ CK7, CK5/6,
actin.
3.3.3. Mức độ bộc lộ PSA của tế bào u
Bảng 3.16. Mức độ bộc lộ PSA của tế bào u
Mô bệnh học UTBM tuyến nang
Mức độ

UTBM tuyến ống

(n=29)

(n=2)

(-)

0 (0%)

0/2

(1+)

7 (24,2%)

0/2

(2+)

13 (44,8%)

2/2


17
(3+)

9 (31%)

0/2

(4+)

0 (0%)

0/2

3.3.4. Phân bố mức độ bộc lộ PSA của tế bào u theo độ Gleason
Bảng 3.17. Mức

độ bộc lộ PSA theo độ Gleason (n=31)

Độ Gleason
Mức độ

Độ Độ Độ Độ
2

3

(1+)
(2+)
(3+)

Tổng

4

5

(%)

5

2

7 (22.6%)

15

Spearman

15 (48.4%) rho=-0,996

9

9 (29%)

(4+)

p< 0,001

0 (0%)

Có sự liên quan nghịch giữa mức độ bộc lộ PSA và độ Gleason.
Độ Gleason càng cao, bộc lộ PSA càng yếu (p < 0,001).
3.3.5. Mức độ bộc lộ PSA của tế bào u xâm nhập dây thần kinh
- Bộc lộ PSA ở mức độ trung bình chiếm tỷ lệ 53,85%.
- Bộc lộ PSA ở mức độ yếu chiếm tỷ lệ 46,15%.
3.3.6. Tình trạng bộc lộ CK34βE12 và p63 của tế bào đáy
Bảng 3.19. Tình trạng bộc lộ 34βE12 và p63 của tế bào đáy
Mô bệnh học

Dấu ấn (n=33)
34βE12

UTBM tuyến

Vùng tuyến lành tính
Vùng tuyến ung thư

UT đường niệu

31

Vùng tuyến lành tính
Vùng ung thư

2

(+)
(-)
(+)
(+)

p63
31

2

(+)
(-)
(+)
(+)

- UTBM tuyến: vùng tuyến lành bộc lộ CK34βE12 và p63, ngược lại
vùng tuyến UT không bộc lộ CK34βE12 và p63.
- UTBM đường niệu: vùng tuyến lành và vùng UT bộc lộ CK34βE12


18
và p63.
3.3.8. Tình trạng và mức độ bộc lộ CK7 và CK5/6 của biểu mô
đường niệu lành tính và ác tính
Bảng 3.21. Tình trạng và mức độ bộc lộ CK7 và CK5/6 của biểu mô
đường niệu lành tính và ác tính
Dấu ấn (n=33)
CK7
CK5/6
UTBM tuyến
Vùng tuyến lành tính
(4+)
(-)
31
31
Vùng tuyến ung thư
(-)
(-)
UT đường niệu Vùng tuyến lành tính
(4+)
(-)
2
2
Vùng ung thư
(-)
(-)
- UTBM tuyến: BM đường niệu vùng tuyến lành bộc lộ CK7, nhưng
Mô bệnh học

không bộc lộ CK5/6. Vùng tuyến UT không bộc lộ CK7 và CK5/6.
- UTBM đường niệu: BM vùng tuyến lành bộc lộ CK7, không
bộc lộ CK5/6. Vùng UT không bộc lộ CK7 và CK5/6.
3.3.9. Tình trạng và mức độ bộc lộ actin của các loại tế bào mô
đệm
- Toàn bộ TB cơ trơn mô đệm TTL và cơ trơn thành mạch bộc lộ
actin.
- Toàn bộ TB xơ, TB đáy, TB nội mô không bộc lộ actin.
3.4. Kết quả nghiên cứu tình trạng methyl hóa gen RASSF1A
3.4.2. Kết quả đánh giá hiệu quả của quá trình xử lý bisulfite
PCR với cặp mồi GL-F/GL-R nhằm khuếch đại gen β-globin
từ ADN tổng số trước và sau xử lý với bisulfite được trình bày
trên hình 3.2.


19
Hình 3.2. Sản phẩm PCR nhân bản gen β-globin từ khuôn ADN trước (băng đỏ) và
sau xử lý (băng vàng) với bisulfite của một số mẫu mô ung thư (từ p1-p7).

Trước khi xử lý với bisulfite, các mẫu đều lên băng với kích
thước là 250 bp. Sau khi xử lý với bisulfite, chúng tôi không thu
được sản phẩm này. Điều đó chứng tỏ các mẫu ADN tổng số đã được
xử lý hoàn toàn với bisulfite.
3.4.3. Kết quả xác định sự methyl hóa gen RASSF1A ở các mẫu
ung thư
Băng ADN đặc hiệu của gen RASSF1A bị methyl hóa có kích
thước 170 bp (ký hiệu m) được phát hiện trong 11/20 mẫu UT. Băng
ADN đặc hiệu cho RASSF1A không bị methyl hóa có kích thước 137
bp (ký hiệu u) cũng được phát hiện trong 20 mẫu UT. Đây là sản
phẩm đặc trưng cho các TB lành lẫn trong mẫu UT.

Hình 3.3. Sản phẩm MSP nhân bản gen RASSF1A từ khuôn ADN bị xử lý bằng bisulfite
của 20 mẫu ung thư (từ P1 đến P20) với cặp mồi methyl RASSF1A-M210-F/RASSF1AM211-R và cặp mồi không methyl RASSF1A-Un-F2/ RASSF1A-Un-R2.


20
3.4.4. Kết quả xác định sự methyl hóa gen RASSF1A
ở các mẫu tăng sản TTL

Hình 3.4. Sản phẩm MSP nhân bản gen RASSF1A từ khuôn ADN bị xử lý với
bisulfite của 10 mẫu tăng sản TTL (từ B1 đến B10).
Ghi chú: (m): ký hiệu băng ADN bị methyl hóa, (u): ký hiệu băng ADN không bị
methyl hóa. (-): đối chứng âm (nước thay cho ADN khuôn).

Tất cả các mẫu mô tăng sản TTL có băng ADN đặc hiệu cho
RASSF1A không bị methyl hóa (ký hiệu u) với kích thước là 137 bp.
Băng ADN đặc hiệu cho RASSF1A bị methyl hóa có kích thước 170
bp phát hiện trong 2/10 mẫu tăng sản TTL.
3.4.5. Đối chiếu tình trạng methyl hóa gen RASSF1A với một số
đặc điểm MBH trong ung thư biểu mô tuyến
3.4.5.1. Methyl hóa gen RASSF1A trong ung thư biểu mô tuyến và
tăng sản lành tính TTL
Bảng 3.23. Tỷ lệ methyl hóa trong ung thư và tăng sản TTL
Mô bệnh học

Số lượng (n=30)

Tỷ lệ methyl hóa (%)

Ung thư TTL

20

11/20 (55%)

Tăng sản TTL

10

2/10 (20%)

Tỷ lệ methyl hóa gen RASSF1A trong UTBM tuyến là 55%, trong
tăng sản TTL là 20%.


21
3.4.5.3. Methyl hóa gen RASSF1A và điểm Gleason/độ biệt hóa
Bảng 3.25. Tỷ

lệ methyl hóa theo điểm Gleason/độ
biệt hóa
Số lượng

Tỷ lệ methyl hóa

(n=20)

(n %)

Cao

7

2 (28,6%)

5-7

Vừa

8

4 (50%)

8-10

Thấp

5

5 (100%)

Điểm Gleason

Độ biệt hóa

2-4

Spearman
rho=0,530; p=0,016
Tỷ lệ methyl hóa tăng cao theo điểm Gleason/độ biệt hóa của
khối u.
3.4.5.4. Methyl hóa gen RASSF1A và tình trạng u xâm lấn dây TK
Bảng 3.26. Tỷ lệ methyl hóa theo tình trạng u xâm lấn dây TK
Xâm lấn dây TK

Số mẫu

Tỷ lệ methyl hóa

(n=20)

(n%)



7

6/7 (85,7%)

Không

13

5/13 (38,5%)

Spearman

rho=0,453; p=0,045

Tỷ lệ methyl hóa ở nhóm khối u xâm lấn dây TK chiếm tỷ lệ cao
(85,7%).
3.4.5.5. Methyl hóa gen RASSF1A và tình trạng PIN trong tăng sản TTL
Bảng 3.27. Tỷ lệ methyl hóa gen RASSF1A và tình trạng PIN độ thấp
trong tăng sản TTL
Số mẫu

Tỷ lệ methyl hóa

(n=10)

(n%)

Tăng sản TTL phối hợp PIN độ thấp

5

2/5 (40%)

Tăng sản TTL không phối hợp PIN

5

0/5 (0%)

Mô bệnh học


22
Tỷ lệ methyl hóa ở nhóm tăng sản TTL phối hợp với PIN độ
thấp là 40%. Không phát hiện methyl hóa ở nhóm tăng sản TTL
không phối hợp với PIN.
Chương 4. BÀN LUẬN
4.1. Tỷ lệ bệnh nhân ung thư biểu mô tuyến tiền liệt theo nhóm tuổi
Tỷ lệ BN mắc UTBM TTL tăng theo nhóm tuổi: nhóm 70-79
chiếm tỷ lệ cao nhất (42,86%), nhóm 40-49 chiếm tỷ lệ rất thấp
(1,19%). Kết quả (KQ) này phù hợp với KQ Nguyễn Việt Hải (2013),
Ngô Văn Trung (2004) và Gronberg H. (2003).
4.2. Một số đặc điểm mô bệnh học ung thư biểu mô tuyến tiền liệt
4.2.1. Xác định típ MBH, các thể và các biến thể
+ Xác định được 2/4 típ mô bệnh học UTBM TTL nguyên phát:
UTBM tuyến và UTBM đường niệu. Không gặp UTBM tế bào vảy
và UTBM tế bào đáy.
+ Xác định được UTBM tuyến nguyên phát chiếm 97,6%. KQ
của chúng tôi cao hơn Nguyễn Văn Hưng (2004), tương đương với
KQ của Nguyễn Việt Hải (2013). Xác định được UTBM đường niệu
nguyên phát (2,4%), phù hợp với công bố của Eble. J.N (2004) và
Mostofi (1992).
+ Xác định được UTBM tuyến thể tuyến nang chiếm tỷ lệ
97,6%. KQ này cao hơn Nguyễn Văn Hưng (2004), phù hợp với các
thông báo trước đây. UTBM tuyến ống chiếm 2,4%, đây là thể rất
hiếm gặp, KQ phù hợp với các công bố trong y văn.
+ Trong UTBM tuyến thể tuyến nang: biến thể tuyến nang thông
thường hay gặp nhất (87,5%), ít gặp biến thể teo đét (5%) và biến thể
giả tăng sản (7,5%), không gặp biến thể tuyến bọt, TB nhẫn, dạng
chất keo/nhày, TB hạt ưa eosin, giống limphô-biểu mô và dạng
sacôm. KQ phù hợp với thông báo của Eble. J. N (2004).


23
4.2.2. UTBM tuyến phối hợp với PIN độ cao
Tỷ lệ UTBM tuyến phối hợp với PIN độ cao là 73,2%, không
phối hợp với PIN độ cao là 26,8%, phù hợp với Nguyễn Văn Hưng
(2005) và Alexander E. E. (1996).
UTBM tuyến phối hợp với PIN độ cao chiếm tỷ lệ cao nhất ở
nhóm u điểm Gleason 5-7 (biệt hóa vừa) là 66,7%, chiếm tỷ lệ thấp là
nhóm biệt hóa cao và kém biệt hóa. KQ phù hợp một phần với các
tác giả nước ngoài như: Eptain JL. (1995), Erbersdobler A. (1996),
Hagman M. J. (1997), Montoroni R. (1999), Paradis V. (1999).
4.2.3. Độ mô học trong ung thư biểu mô tuyến tiền liệt
+ Độ 3 Gleason hay gặp mẫu thứ nhất (46,3%), độ 4 Gleason
hay gặp ở mẫu thứ 2 (43,9%), các độ Gleason còn lại chiếm tỷ lệ
thấp. Phù hợp với Nguyễn Văn Hưng (2005) và Samaratunga H.
(2014). Eble. J. N (2004) thông báo UTBM TTL thường có nhiều
mẫu mô học trong cùng một u.
+ Nhóm điểm Gleason 5-7 chiếm tỷ lệ cao nhất (70,7%), phù
hợp với Sgrignoli A. (1994), Samaratunga H. (2014). Nhóm điểm
Gleason 2-4 (17,1%) cao hơn Nguyễn Văn Hưng (2005) và
Oesterling (1987), nhóm Gleason 8-10 (12,2%) thấp hơn so với
Nguyễn Việt Hải (2013) và Nguyễn Văn Hưng (2005). Theo chúng
tôi, sự khác nhau này là do lựa chọn đối tượng nghiên cứu.
4.2.4. Các đặc điểm đặc trưng ác tính trong UTBM tuyến
+ U có các đặc điểm đặc trưng ác tính chiếm tỷ lệ 69,5%, u
không có đặc điểm đặc trưng ác tính chiếm tỷ lệ 30,5% (p<0,001).
+ Tỷ lệ u xâm nhập dây TK là 39%, thấp hơn Eble. J. N (2004). Theo
chúng tôi, KQ này có thể do lựa chọn đối tượng nghiên cứu.
+ Tỷ lệ u tăng sinh xơ-nhày 11%, chỉ gặp ở nhóm u điểm
Gleason 5-7 và 8-10, KQ phù hợp với Christian J. D. (2005).
+ Cấu trúc tuyến UT giống tiểu cầu thận chiếm 12,2%, chỉ thấy
trong nhóm u điểm Gleason 5-7 và Gleason 8-10.


24
4.2.5. Các đặc điểm chất chứa trong lòng tuyến nang ác tính
+ Nhóm u chứa tinh thể/chất tiết kết đặc màu hồng (85,4%)
chiếm tỷ lệ cao hơn nhóm u không chứa tinh thể/chất tiết kết đặc màu
hồng (14,6%), với p<0,001.
+ U chứa tinh thể ưa eosin (9,7%), phù hợp với Young (2000)
nhưng cao hơn Nguyễn Văn Hưng (2005).
+ U chứa chất tiết kết đặc màu hồng (53,7%), phù hợp với
Iczkowski K. A. (1999) và Christian J. D. (2005).
+ U chứa chất tiết kết đặc màu hồng/chất tinh thể (22%). U
không chứa chất tiết kết đặc màu hồng/tinh thể (14,6%).
4.3. Sự bộc lộ một số dấu ấn miễn dịch và tình trạng methyl hóa
gen RASSF1A trong ung thư biểu mô tuyến tiền liệt
4.3.1. Sự bộc lộ một số dấu ấn miễn dịch .
* Kháng nguyên đặc hiệu TTL (prostate specific antigen: PSA)
UTBM TTL nguyên phát bộc lộ PSA với tỷ lệ cao (94%) còn lại
(6%) không bộc lộ PSA, KQ phù hợp Nguyễn Văn Hưng (2005) và
Brimo F. (2012).
+ Gleason độ 4 và độ 5 bộc lộ PSA mức độ yếu, độ 3 bộc lộ
PSA mức độ trung bình, độ 2 bộc lộ PSA mức độ mạnh. TB u thuộc
vùng độ Gleason càng cao (kém biệt hóa) thì mức độ bộc lộ càng yếu
(p < 0,001). KQ này phù hợp với thông báo trong y văn.
+ UTBM đường niệu nguyên phát không bộc lộ PSA, phù hợp với
công bố của Eble. J. N. (2004) và các NC trước đây.
+ U xâm nhập dây TK bộc lộ PSA mức độ yếu (46,2%), bộc lộ
PSA mức độ trung bình (53,8%). Phù hợp Epstein J. I. (2014) và các
NC trước đây.
* Cytokeratin trọng lượng phân tử cao dòng 34betaE12
(CK34βE12)
+ Vùng tuyến UT không bộc lộ CK34βE12, phù hợp với các
thông báo trong y văn.


25
+ Vùng tuyến lành và vùng UTBM đường niệu tại chỗ bộc lộ
CK34βE12. Mức độ bộc lộ CK34βE12 từ trung bình (69,7%) đến mạnh
(30,3%), phù hợp một phần với KQ của Nguyễn Văn Hưng (2005).
* p63
+ Vùng tuyến UT không bộc lộ p63 .
+ Vùng tuyến lành tính, vùng UTBM đường niệu tại chỗ bộc lộ p63.
+ UTBM đường niệu nguyên phát: các TB đáy còn sót lại nằm
viền quanh vùng UT đường niệu tại chỗ bộc lộ CK34βE12 và p63.
+ Vùng tuyến lành tính, các TB đáy bộc lộ p63 mức độ mạnh
(81,8%) chiếm tỷ lệ cao, bộc lộ mức độ trung bình (18,2%) chiếm tỷ
lệ thấp, KQ phù hợp với các NC trước đây.
* Cytokeratin 7
BM đường niệu lành tính bộc lộ CK7 với mức độ rất mạnh ở
tất cả trường hợp. Trong khi đó, UTBM đường niệu nguyên phát
không bộc lộ CK7, KQ này tương tự với KQ của Nguyễn Văn Hưng
(2005). Sử dụng CK7 sẽ góp phần phân biệt UTBM đường niệu TTL
nguyên phát với thứ phát và phân biệt UTBM đường niệu với các
loại UTBM khác.
* Cytokeratin 5/6
BM chế tiết TTL ác tính, lành tính và BM đường niệu lành
tính, BM đường niệu ác tính không bộc lộ CK5/6, phù hợp với các
công bố trong y văn. Do đó, sử dụng CK5/6 để trợ giúp xác định
UTBM TTL loại tế bào vảy, UTBM đường niệu nguyên phát, di căn
UTBM tế bào vảy...
* Actin đặc trưng cơ
Các TB cơ trơn thuộc mô đệm TTL và cơ trơn thành mạch máu
bộc lộ actin ở mức độ rất mạnh. TB xơ, TB đáy, TB nội mô thuộc mô
đệm TTL không bộc lộ actin. KQ phù hợp với các công bố trong y


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×