Tải bản đầy đủ

Khảo sát vi khuẩn escherichia coli sinh beta lactamase phổ rộng trên gà tại một số trại chăn nuôi ở đồng bằng sông cửu long tóm tắt

BỘ GIÁO DỤC VÀ ĐÀO TẠO
TRƢỜNG ĐẠI HỌC CẦN THƠ

TÓM TẮT LUẬN ÁN TIẾN SĨ
Chuyên ngành: Bệnh lý học và chữa bệnh vật nuôi
Mã ngành: 62 64 01 02

BÙI THỊ LÊ MINH

KHẢO SÁT VI KHUẨN ESCHERICHIA COLI SINH
BETA-LACTAMASE PHỔ RỘNG TRÊN GÀ TẠI
MỘT SỐ TRẠI CHĂN NUÔI Ở ĐỒNG BẰNG
SÔNG CỬU LONG

Cần Thơ, 2018


CÔNG TRÌNH ĐƢỢC HOÀN THÀNH TẠI
TRƢỜNG ĐẠI HỌC CẦN THƠ

Người hướng dẫn: PGS.TS. Lưu Hữu Mãnh


Luận án được bảo vệ trước hội đồng chấm luận án tiến sĩ cấp trường
Họp tại: ……………………….……, Trường Đại học Cần Thơ
Vào lúc ….. giờ ….. ngày ….. tháng ….. năm 2018

Phản biện 1: ………………………………
Phản biện 2: ………………………………
Phản biện 3: ………………………………

Có thể tìm hiểu luận án tại thư viện:
Trung tâm Học liệu, Trường Đại học Cần Thơ.
Thư viện Quốc gia Việt Nam.


DANH MỤC CÁC CÔNG TRÌNH ĐÃ CÔNG BỐ
A. Các bài báo đã công bố
1. Bùi Thị Lê Minh, Lưu Hữu Mãnh, Nguyễn Nhựt Xuân Dung, 2016.
Khảo sát sự hiện diện Escherichia coli sinh β-lactamase phổ rộng trên
gà khỏe ở tỉnh Vĩnh Long. Tạp chí Khoa học kỹ thuật thú y, số 2: 22-27.
2. Bùi Thị Lê Minh, Lưu Hữu Mãnh, Nguyễn Nhựt Xuân Dung, 2016.
Khảo sát sự hiện diện gen CTX-M, TEM và SHV ở Escherichia coli
sinh β-lactamase phổ rộng phân lập từ gà ở tỉnh Trà Vinh. Tạp chí Khoa
học Trường Đại học Cần Thơ, số 42(b): 1-6.
3. Bùi Thị Lê Minh, Lưu Hữu Mãnh, Nguyễn Nhựt Xuân Dung, 2016.
Kết quả khảo sát Escherichia coli sinh β-lactamase phổ rộng trên gà tại
một số cơ sở giết mổ ở tỉnh Vĩnh Long. Tạp chí Khoa học Trường Đại
học Cần Thơ, số chuyên đề tập 2: 1-5.
4. Bùi Thị Lê Minh, Lưu Hữu Mãnh, Nguyễn Nhựt Xuân Dung, 2016.
Tình hình nhiễm Escherichia coli sinh β-lactamase phổ rộng trên gà
bệnh ở tỉnh Vĩnh Long. Tạp chí Khoa học Trường Đại học Cần Thơ, số
chuyên đề tập 2: 6-10.
5. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Study of extended spectrum beta-lactamase producing Escherichia coli
isolated from sick chickens in Hau Giang province. Proceeding of The
19th Federation of Asian Veterinary Associations Congress, September
6-9th 2016, Ho Chi Minh city. Vietnam National University-Ho Chi
Minh city Press, 148-150.
6. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Occurrence of extended spectrum beta-lactamase producing
Escherichia coli in chickens from slaughter houses in the Mekong delta


of Vietnam. Proceedings international conference on agriculture
development in the context of international integration: Opportunities
and challenges, December 7-8th 2016, Ha Noi. Agriculture University
Press, 198-202.
7. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2017.
Occurrence of TEM, SHV and CTX-M genes in diarrhea chickens and
antibiotic resistance. Proceeding of 33th World Veterinary Congress,
August 27-31 2017, Incheon-Korea.


8. Bùi Thị Lê Minh, Lưu Hữu Mãnh, Nguyễn Nhựt Xuân Dung, 2018.
Tình hình nhiễm Escherichia coli sinh beta-lactamase phổ rộng trên
người chăn nuôi gà ở Đồng bằng sông Cửu Long. Tạp chí Khoa học
Trường Đại học Cần Thơ, số chuyên đề tập 54: 1-5.

B. Các đề tài nghiên cứu khoa học đã đƣợc nghiệm thu
1. Bùi Thị Lê Minh (chủ nhiệm đề tài). Khảo sát vi khuẩn Escherichia
coli sinh beta-lactamase phổ rộng trên gà và kiểm tra độ nhạy của một
số loại kháng sinh. Đề tài nghiên cứu khoa học cấp Trường Đại học
Cần Thơ, 2015, mã số T2015 -62.
2. Bùi Thị Lê Minh (chủ nhiệm đề tài). Khảo sát gen bla CTX-M, bla
TEM và bla SHV trên Escherichia coli sinh beta-lactamase phổ rộng
phân lập từ gà bệnh ở tỉnh Vĩnh Long. Đề tài nghiên cứu khoa học cấp
Trường Đại học Cần Thơ, 2016, mã số T2016 -52.
3. Bùi Thị Lê Minh (chủ nhiệm đề tài). Khảo sát gen TEM, SHV và
CTX-M trên Escherichia coli sinh beta-lactamase phổ rộng phân lập từ
người chăn nuôi gà ở Đồng bằng sông Cửu Long. Đề tài nghiên cứu
khoa học cấp Trường Đại học Cần Thơ, 2017, mã số T2017-50.


CHƢƠNG 1: GIỚI THIỆU
1.1 Tính cấp thiết của luận án
Bệnh E. coli là một trong những bệnh nhiễm khuẩn phổ biến ở gà thịt
và gà đẻ nuôi công nghiệp (Raji et al., 2003). Vi khuẩn E. coli thường
được tìm thấy trong đường tiêu hóa của gà và được bài thải trong phân
do đó gà có thể bị nhiễm qua phân, nước uống, bụi và môi trường bị ô
nhiễm. Sự nhiễm trùng E. coli có thể dẫn đến nhiều thể bệnh cục bộ và
hệ thống như là viêm ống dẫn trứng, viêm dịch hoàn, viêm túi noãn
hoàng, viêm ruột tiêu chảy, viêm màng não, viêm mắt, viêm khớp,
viêm đường hô hấp. Bệnh E. coli xảy ra ở gà mọi lứa tuổi, gây bệnh số
và tử số cao dẫn đến thiệt hại kinh tế cho người chăn nuôi (Barnes et
al., 2008). Ngày nay, việc sử dụng kháng sinh thường xuyên trong thức
ăn, nước uống để phòng và trị bệnh cũng như kích thích tăng trưởng
dẫn đến áp lực chọn lọc trên vi khuẩn, làm xuất hiện các chủng E. coli
đề kháng với nhiều loại kháng sinh làm cho việc điều trị bệnh bằng
kháng sinh có hiệu quả thấp (Linder, 2015). Trong những năm gần đây,
các chủng vi khuẩn kháng thuốc ngày càng nhiều và đề kháng kháng
sinh là vấn đề được quan tâm nghiên cứu sâu rộng trên thế giới, đặc biệt
vi khuẩn E. coli sinh beta-lactamase phổ rộng (E. coli sinh ESBL). Bởi
vì vi khuẩn E. coli sinh ESBL không chỉ có khả năng bất hoạt hầu hết
kháng sinh nhóm beta-lactam đang dùng phổ biến hiện nay mà còn đề
kháng với nhiều nhóm kháng sinh khác được sử dụng phổ biến như
aminoglycoside, macrolide, chloramphenicol, tetracycline và
fluoroquinolone (Lee, 2006).
Nhiều nghiên cứu về E. coli sinh ESBL trên gia súc và trên người đã
được thực hiện ở nhiều nước trên thế giới. Một số báo cáo đã công bố
như Blanc et al. (2006) tìm thấy tỉ lệ nhiễm E. coli sinh ESBL trên gà ở
Catalonia, Tây Ban Nha là 59,8%. Ở Bỉ, Smet et al. (2008) đã xác định
sự hiện diện của E. coli sinh ESBL trên gà 5 tuần tuổi khỏe mạnh là
45%. Nghiên cứu của Costa et al. (2009) trên 76 mẫu phân gà thịt ở cơ
sở giết mổ miền Bắc của Bồ Đào Nha cho thấy sự hiện diện của E. coli

1


sinh ESBL là 38,2%. Mamza et al. (2010) nghiên cứu trên gà ở
Maiduguri, Nigeria cho thấy tỉ lệ nhiễm E. coli trên gà khỏe là 4,3%
(25/582), trên gà bệnh là 28,7% (64/223), trong đó tỉ lệ nhiễm E. coli
sinh ESBL trên gà là 11,1% (89/805). Báo cáo của Overdevest et al.
(2011) ở Hà Lan năm 2009 cho thấy có 79,8% (68/89) mẫu thịt gà tại
cửa hàng dương tính với vi khuẩn E. coli sinh ESBL và 74,2% (23/31)
bệnh nhân được điều trị từ 4 bệnh viện dương tính với E. coli sinh
ESBL.
Ở Việt Nam, một số công trình nghiên cứu về E. coli sinh ESBL trên
động vật, sản phẩm chăn nuôi và môi trường đã được công bố: Van Thi
Thu Hao et al. (2008) khảo sát sự hiện diện của E. coli sinh ESBL trên
30 mẫu thịt gà, 50 mẫu thịt heo được thu thập từ chợ và siêu thị xung
quanh thành phố Hồ Chí Minh, 43 mẫu phân của gà trên 1 tháng tuổi,
kết quả cho thấy tỉ lệ nhiễm vi khuẩn E. coli sinh ESBL trên thịt gà là
89,5%, trên thịt heo là 75% và trên phân gà là 95%. Võ Thành Thìn và
ctv. (2011) nghiên cứu gen đề kháng kháng sinh nhóm beta-lactam đối
với các chủng E. coli phân lập từ heo con tiêu chảy ở Nam Trung Bộ và
Tây Nguyên cho thấy có 115/184 chủng E. coli có khả năng sinh ít nhất
một loại beta-lactamase, chiếm tỉ lệ cao nhất là beta-lactamase được mã
hóa bởi gen TEM (61,96%) và SHV (0,54%). Kết quả nghiên cứu của
Bùi Thị Ba và ctv. (2012) trên E. coli phân lập từ trâu bò khỏe mạnh tại
một số tỉnh Nam Trung Bộ cho thấy có 64,70% (22/34) chủng E. coli
có khả năng sinh ít nhất một loại beta-lactamase, chiếm tỉ lệ cao nhất là
beta-lactamase có kiểu gen TEM (64,70%) và SHV (11,76%). Hồ Thị
Kim Hoa và ctv. (2013) nghiên cứu trên 45 mẫu chất thải (15 mẫu nước
thải tươi, 15 mẫu nước thải biogas và 15 mẫu phân gà) cho thấy có
82,22% (37/45) mẫu dương tính với gen mã hóa beta-lactamase phổ
rộng TEM, 8,89% (4/45) mẫu dương tính với SHV, không phát hiện
mẫu nào dương tính với CTX-M.
Các kết quả nghiên cứu trên thế giới và ở Việt Nam nêu trên cho thấy
vi khuẩn E. coli sinh ESBL không chỉ hiện diện trên gia súc gia cầm mà

2


còn hiện diện trên nhiều đối tượng khác có liên quan như người chăn
nuôi, sản phẩm thịt và các yếu tố môi trường khác. Đồng bằng sông
Cửu Long có nền chăn nuôi gia cầm khá phát triển, đứng sau các tỉnh
miền Đông Nam Bộ, đặc biệt là chăn nuôi gà công nghiệp và gà thả
vườn giống địa phương. Cũng như các vùng chăn nuôi khác trên cả
nước, vấn đề dịch bệnh trên gà nói chung và bệnh do E. coli đặc biệt là
E. coli sinh ESBL nói riêng xảy ra trong vùng Đồng bằng sông Cửu
Long là vấn đề quan tâm của các nhà chăn nuôi và các nhà khoa học do
chúng hiện diện trên nhiều đối tượng và đề kháng với nhiều nhóm
kháng sinh khác nhau. Tuy nhiên, thông tin về sự lưu hành của vi khuẩn
E. coli sinh ESBL vẫn còn rất hạn chế. Vì vậy, để có thêm cơ sở cho
việc phòng trị bệnh do E. coli sinh ESBL trên gia cầm; phòng tránh sự
vấy nhiễm từ gia cầm sang các đối tượng khác đặc biệt là người chăn
nuôi, luận án được tiến hành để nghiên cứu về sự lưu hành của E. coli
sinh ESBL trên gà và các yếu tố khác có liên quan cũng như thực trạng
đề kháng kháng sinh của E. coli sinh ESBL làm cơ sở khoa học ban đầu
cho các nghiên cứu tiếp theo giúp cho việc phòng trị bệnh E. coli trên
gà có hiệu quả hơn và giảm thiểu sự lan truyền vi khuẩn đề kháng
kháng sinh từ chăn nuôi sang con người.
1.2 Mục tiêu nghiên cứu
- Xác định sự lưu hành của E. coli sinh ESBL trên gà nuôi ở quy mô
trang trại và hộ gia đình, các yếu tố có liên quan như trứng gà, người
chăn nuôi gà, thịt gà ở cơ sở giết mổ và các yếu tố môi trường tại khu
vực chăn nuôi và cơ sở giết mổ ở một số tỉnh Đồng bằng sông Cửu
Long.
- Xác định đặc tính đề kháng kháng sinh của E. coli sinh ESBL đối với
một số loại kháng sinh được sử dụng phổ biến trên gà.
- Đánh giá sự tương đồng di truyền của gen CTX-M và TEM ở E. coli
sinh ESBL phân lập từ gà, trứng, người chăn nuôi gà và môi trường
chăn nuôi.
1.3 Những điểm mới của luận án

3


- Đã xác định được sự lưu hành của E. coli sinh ESBL trên gà ở quy mô
trang trại và hộ gia đình với tỉ lệ cao. Các yếu tố có liên quan như trứng
gà, người chăn nuôi gà, thịt gà ở cơ sở giết mổ và các yếu tố môi trường
tại khu vực chăn nuôi và cơ sở giết mổ gia cầm được ghi nhận đều có
sự hiện diện của E. coli sinh ESBL.
- Xác định được vi khuẩn E. coli sinh ESBL trên gà còn nhạy cảm cao
với một số loại kháng sinh như aminkacin, fosformycin và colistin.
- Đã xác định được sự tương đồng di truyền cao của gen CTX-M và
TEM trên vi khuẩn E. coli sinh ESBL phân lập từ gà, trứng, người chăn
nuôi gà và môi trường chăn nuôi.
CHƢƠNG 2: PHƢƠNG TIỆN VÀ PHƢƠNG PHÁP
NGHIÊN CỨU
2.1 Nội dung, thời gian và địa điểm nghiên cứu
Đề tài thực hiện ba nội dung nghiên cứu sau
Nội dung 1: Khảo sát sự hiện diện của E. coli sinh ESBL trên gà nuôi ở
quy mô trang trại và hộ gia đình, trứng gà, thịt gà ở cơ sở giết mổ,
người chăn nuôi gà và một số yếu tố môi trường ở khu vực chăn nuôi
và cơ sở giết mổ.
Mục tiêu là xác định tỉ lệ nhiễm E. coli sinh ESBL trên từng đối tượng
nghiên cứu để tìm ra sự lưu hành của vi khuẩn trên gà và các đối tượng
có liên quan đến chăn nuôi gà.
Nội dung 2: Khảo sát sự đề kháng kháng sinh của E. coli sinh ESBL
đối với một số loại kháng sinh bao gồm nhóm beta lactams và các loại
đang sử dụng phổ biến cho gà.
Mục tiêu là tìm những kháng sinh còn hiệu quả đối với vi khuẩn E. coli
sinh ESBL trong số các kháng sinh được sử dụng phổ biến trong chăn
nuôi nhằm phục vụ cho việc phòng trị bệnh E. coli có hiệu quả hơn.
Nội dung 3: Phân tích trình tự nucleotide của một số gen mã hóa betalactamase phổ rộng và xây dựng cây phả hệ di truyền.
Xác định sự hiện diện của các gen CTX-M, TEM mã hóa betalactamase phổ rộng, giải trình tự nucleotide của các gen này và xây

4


dựng cây phả hệ di truyền. Mục tiêu tìm xem có sự tương đồng di
truyền của các gen này trên vi khuẩn E. coli sinh ESBL phân lập từ gà,
trứng, môi trường chăn nuôi và người chăn nuôi, giúp ngăn ngừa sự lây
truyền vi khuẩn đề kháng sinh trong chăn nuôi gà cũng như ngăn ngừa
sự lây truyền vi khuẩn đề kháng sinh từ động vật sang người góp phần
bảo vệ sức khỏe cộng đồng.
Thời gian nghiên cứu: Từ năm 2014 đến năm 2017.
Địa điểm thu thập mẫu: Tại 304 hộ và 104 trang trại chăn nuôi gà, 12
cơ sở giết mổ ở Đồng bằng sông Cửu Long gồm các tỉnh Vĩnh Long,
Trà Vinh, Sóc Trăng và Hậu Giang.
Địa điểm phân tích mẫu: Phân lập vi khuẩn, khảo sát tính nhạy cảm của
vi khuẩn với kháng sinh được và thực hiện phản ứng PCR tại Trường
Đại học Cần Thơ, phân tích trình tự nucleotide của gen tại Công ty
Macrogen, Hàn Quốc.
2.2 Phƣơng tiện nghiên cứu
Các thiết bị cần thiết bao gồm tủ đông, máy tiệt trùng ướt, máy tiệt
trùng khô, tủ ấm, máy lắc, máy quang phổ UV-VIS, hệ thống PCR.
Môi trường và hóa chất dùng trong nuôi cấy, phân lập và định danh vi
khuẩn E. coli. Giấy tẩm kháng sinh các loại. Các loại hóa chất sử dụng
cho PCR, giải mã gen.
2.3 Phƣơng pháp nghiên cứu
2.3.1 Phƣơng pháp thu thập mẫu
Mẫu thí nghiệm được thu thập tại 2 khu vực là khu vực chăn nuôi gà và
cơ sở giết mổ. Ở khu vực chăn nuôi, mẫu được thu thập theo hai quy
mô chăn nuôi là chăn nuôi gà ở quy mô hộ gia đình (50-180 con gà/hộ)
và trang trại (6.000-14.000 con gà/trại). Ở hộ gia đình, hình thức chăn
nuôi gà thịt và gà đẻ trên nền chuồng. Ở trang trại, hình thức chăn nuôi
gà thịt trên nền chuồng và gà đẻ nuôi trên chuồng lồng.
Tổng số 408 hộ/trại (304 hộ gia đình và 104 trang trại) được khảo sát.
Để phân tích sự tương đồng di truyền của các gen TEM và CTX-M, 80

5


hộ/trại (60 hộ gia đình và 20 trang trại) được thu thập các loại mẫu trên
trứng, gà, người chăn nuôi gà và môi trường chăn nuôi (gồm nước sinh
hoạt, nước máng uống, thức ăn máng ăn và không khí chuồng nuôi).
Bên cạnh đó, 12 cơ sở giết mổ tập trung được khảo sát trong đó 1 cơ sở
dây chuyền giết mổ treo và 11 cơ sở giết mổ trên nền. Mỗi tỉnh chọn 3
cơ sở giết mổ với công suất lớn, phân phối thịt gà chủ yếu trong tỉnh.
Tại cơ sở giết mổ, các mẫu được thu thập gồm gà và môi trường giết
mổ (nước sinh hoạt, nước vặt lông con, nước thải, không khí và mẫu
swab sàn pha lóc thịt).
Mẫu được thu thập tại các tỉnh Vĩnh Long (thị xã Bình Minh, các huyện
Bình Tân, Mang Thít, Trà Ôn, Tam Bình, Long Hồ), Trà Vinh (thành
phố Trà Vinh, các huyện Tiểu Cần, Càng Long, Cầu Kè, Cầu Ngang,
Châu Thành), Sóc Trăng (các huyện Kế Sách, Châu Thành, Long Phú,
Trần Đề, Ngã Năm, Vĩnh Châu, Long Phú, Mỹ Tú) và Hậu Giang
(thành phố Vị Thanh, các huyện Vị Thủy, Châu Thành, Phụng Hiệp,
Ngã Bảy).
2.3.1.1 Số lượng mẫu thu thập tại hộ gia đình và trang trại
Mẫu được thu thập theo phương pháp điều tra cắt ngang. Số lượng gà
thu thập ở mỗi tỉnh được tính theo công thức tính dung lượng mẫu của
Cannon and Reo (1982) trích dẫn của Thrusfield (2005), ước tính tỉ lệ
lưu hành E. coli sinh ESBL sử dụng phương pháp lấy mẫu ngẫu nhiên
đơn giản: n= Z2*P*(1- P)/d2
Trong đó n: số mẫu cần lấy, P: tỉ lệ lưu hành ước đoán, d: sai số cho
phép với tỉ lệ lưu hành ước đoán. Với độ tin cậy 95%, P=50% và d=5%,
số lượng gà thu thập tối thiểu ở mỗi tỉnh là 384 con gà.
Tổng số gà khỏe và gà có triệu chứng tiêu chảy thu thập ở 4 tỉnh là
2.040 con gà, 5 - 6 con gà được thu thập tại mỗi hộ hoặc trại. Đối với
gà có trạng thái khỏe mạnh, mẫu khảo sát là mẫu phân. Đối với gà có
triệu chứng tiêu chảy, mẫu khảo sát gồm thịt, gan, phổi và phân.

6


Bảng 3.1: Đối tượng mẫu thu thập theo quy mô chăn nuôi
Quy mô chăn nuôi

Đối tượng

Hộ gia đình

Trang trại

Tổng

Gà thịt (con)

858

338

1.196

Gà đẻ (con)

626

218

844

Trứng gà (quả)

200

50

250

Người trực tiếp chăn nuôi gà (người)

60

20

80

Môi trường chăn nuôi (hộ/trại)

60

20

80

Bảng 3.2: Các loại mẫu và số lượng mẫu thu thập tại hộ gia đình và trang trại
Đối tượng
Gà khỏe (n=1.640 con)

Loại mẫu
Phân
Phân
Phổi
Gan
Thịt
Vỏ trứng
Lòng đỏ
Lòng trắng
Phân
Không khí
Thức ăn máng ăn
Nguồn nước
Nước máng uống

Gà có tiệu chứng tiêu chảy (n= 400 con)

Trứng gà (n=250 trứng)
Người trực tiếp chăn nuôi gà (n=80 người)
Môi trường chăn nuôi (n=80 hộ/trại)

Số mẫu
1.640
400
400
400
400
250
250
250
80
400
80
80
80
4.710

Tổng

Bảng 3.3: Số lượng gà thu thập theo hướng sản xuất và lứa tuổi
Hướng sản xuất
Gà thịt
(con)
Gà đẻ (con)
Tổng (con)

≤ 1 tuần
2-4 tuần
> 4 tuần
Tổng

Vĩnh
Long
119
117
100
336
254
590

Trà Vinh
115
115
55
285
265
550

Sóc Trăng

Hậu Giang

115
120
55
290
160
450

115
115
55
285
165
450

Tổng
464
467
265
1.196
844
2.040

2.3.1.2 Số lượng mẫu thu thập tại cơ sở giết mổ
Số lượng gà thu thập tại cơ sở giết mổ được thực hiện theo Quy chuẩn
kỹ thuật quốc gia: Kỹ thuật lấy và bảo quản mẫu thịt tươi từ các cơ sở
giết mổ và kinh doanh thịt để kiểm tra vi sinh vật (QCVN 0104:2009/BNNPTNT). Chọn ngẫu nhiên tối thiểu 15 thân thịt cho một
lần lấy mẫu/cơ sở. Tổng số 180 con gà được thu thập từ 12 cơ sở giết.
Mỗi con gà thu thập 4 loại mẫu gồm thân thịt, gan, phổi và phân.

7


Bảng 3.4: Các lọai mẫu và số lượng mẫu thu thập tại cơ sở giết mổ
Đối tượng

Loại mẫu

Gà (n=180 con)

Môi trường giết mổ (n=12 cơ sở giết mổ)

Số mẫu

Phân

180

Phổi

180

Gan

180

Thịt

180

Không khí

60

Sàn pha lóc

12

Nguồn nước

12

Nước vặt lông

12

Nước thải

12

Tổng

828

2.3.2 Phƣơng pháp nuôi cấy và phân lập E. coli sinh ESBL
Phân lập vi khuẩn E. coli sinh ESBL gồm hai thí nghiệm là thí nghiệm
sàng lọc vi khuẩn sinh ESBL và thí nghiệm xác định kiểu hình ESBL.
Thí nghiệm sàng lọc vi khuẩn E. coli sinh ESBL được thực hiện trên
môi trường MacConkey Agar có bổ sung ceftazidime với liều 2mg/l
(David and Bonomo, 2005) và thí nghiệm xác định kiểu hình ESBL
được thực hiện bằng phương pháp đĩa kết hợp (CLSI, 2014). Thử
nghiệm đặc tính sinh hóa của E. coli theo Mac Faddin (2000). Mẫu sau
khi thu thập được nuôi cấy phân lập vi khuẩn trong vòng 24 giờ.
2.3.3 Phƣơng pháp khảo sát tính nhạy cảm của E. coli sinh ESBL
với kháng sinh
Mỗi mẫu dương tính chọn từ 1 đến 3 vi khuẩn E. coli sinh ESBL có
kiểu hình ESBL khác nhau để khảo sát tính nhạy cảm với kháng sinh.
Tổng cộng có 1.860 vi khuẩn E. coli sinh ESBL phân lập từ 1.265 mẫu
phân gà và 120 vi khuẩn E. coli sinh ESBL phân lập từ 50 người chăn
nuôi gà được kiểm tra tính nhạy cảm với 14 loại kháng sinh. Tính nhạy
cảm kháng sinh của E. coli sinh ESBL được kiểm tra bằng phương
pháp khuếch tán trên thạch của Kirbry-Bauer et al. (1966) theo hướng
dẫn của CLSI (2014).

8


2.3.4 Phƣơng pháp xác định gen CTX-M, TEM và SHV
Tổng số 631 vi khuẩn E. coli sinh ESBL từ 631 mẫu dương tính được
xác định các gen CTX-M, TEM và SHV bằng phương pháp PCR.
Mẫu DNA của vi khuẩn E. coli sinh ESBL được tách chiết bằng
phương pháp sóc nhiệt theo Costa et al. (2010). Các cặp mồi được sử
dụng trong nghiên cứu theo Rasheed et al. (2000), Gniadkowshi et al.
(1998) và Bonnet et al. (2000).
Bảng 3.5: Số vi khuẩn E. coli sinh ESBL được khảo sát gen đề kháng
Địa điểm
Hộ gia đình và trang trại
Cơ sở giết mổ

Đối tượng

Số vi khuẩn


Người chăn nuôi
Vỏ trứng
Môi trường chăn nuôi

Môi trường giết mổ

488
21
12
60
40
10
631

Tổng

Bảng 3.6: Trình tự nucleotide của các mồi sử dụng cho phản ứng PCR
Gen
TEM-F
TEM-R
SHV-F
SHV-R
CTX-MF
CTX-MR

Trình tự nucleotide

bp

ATGAGTATTCAACATTTCCG
TTACTGTCATGCCATCC
ACTGAATGAGGCGCTTCC
ATCCCGCAGATAAATCACC
CGCTTTGCGATGTGCAG
ACCGCGATATCGTTGGT

Tác giả

351

Rasheed et al., 2000

297

Gniadkowshi et al., 1998

550

Bonnet et al., 2000

2.3.5 Phƣơng pháp phân tích trình tự nucleotide của gen TEM và
CTX-M và xây dựng cây phả hệ di truyền
Để phân tích sự tương đồng di truyền của các gen TEM, CTX-M trên vi
khuẩn E. coli sinh ESBL từ gà, vỏ trứng, người chăn nuôi, môi trường
chăn nuôi trong cùng một hộ/trại và giữa 4 tỉnh, tổng số có 17 mẫu
mang gen TEM và 17 mẫu mang gen CTX-M được phân tích trình tự
nucleotide theo phương pháp của Sanger (1977).
Kết quả phân tích trình tự nucleotide của gen TEM và CTX-M được so
so sánh tương đồng di truyền với các gen TEM và CTX-M mã hóa
ESBL trong cơ sở dữ liệu ngân hàng gen thuộc Trung tâm Quốc gia về

9


Thông tin Công nghệ Sinh học của Mỹ (NCBI: National Center for
Biotechnology Information) bằng phương pháp nucleotide Blast. Mức
độ tương đồng nucleotide và amino acid giữa các mẫu được phân tích
bằng phần mềm BioEdit. Phần mềm Mega 6.0 được sử dụng để xây
dựng cây phả hệ di truyền bằng phương pháp Maximum-likelihood.
2.3.6 Các chỉ tiêu theo dõi
Tỉ lệ lưu hành E. coli sinh ESBL trên gà, trứng, người chăn nuôi, môi
trường chăn nuôi và môi trường giết mổ.
Tỉ lệ E. coli sinh ESBL phân lập từ gà và người chăn nuôi gà nhạy cảm,
trung gian, đề kháng với kháng sinh.
Tỉ lệ E. coli sinh ESBL phân lập từ gà và người chăn nuôi gà đa kháng
với kháng sinh.
Tỉ lệ lưu hành gen TEM, SHV, CTX-M trên E. coli sinh ESBL phân lập
từ gà, trứng, người chăn nuôi gà, môi trường chăn nuôi và môi trường
giết mổ.
Xác định sự tương đồng trình tự nucleotide của các gen TEM, CTX-M
trên E. coli sinh ESBL phân lập từ gà, trứng, người chăn nuôi gà và môi
trường chăn nuôi.
Cách tính tỉ lệ (%): R= Số mẫu dương tính * 100/ Số mẫu kiểm tra
2.3.7 Phƣơng pháp phân tích thống kê
Sự khác biệt giữa các tỉ lệ được so sánh bằng phương pháp Chi-Square
Test trên phần mềm Minitab version 16.0.
CHƢƠNG 3: KẾT QUẢ VÀ THẢO LUẬN
3.1 Sự lƣu hành của E. coli sinh ESBL tại hộ gia đình và trang trại
3.1.1 Sự lƣu hành của E. coli sinh ESBL trên gà theo tỉnh
Kết quả nghiên cứu cho thấy tỉ lệ lưu hành của E. coli sinh ESBL trên
gà ở Đồng bằng sông Cửu Long là 62,01%, tỉ lệ lưu hành E. coli sinh
ESBL trên gà ở tỉnh Hậu Giang (44,44%) thấp hơn trên gà ở tỉnh Vĩnh

10


Long (65,93%), Trà Vinh (68,73%) và Sóc Trăng (66,22%) có ý nghĩa
thống kê (P = 0,00).
Một số kết quả nghiên cứu trên thế giới cho thấy tỉ lệ nhiễm E. coli sinh
ESBL trên gà ở Bỉ là 45% (Annemieke Smet et al., 2008), ở Bồ Đào
Nha là 38,2% (Daniela Costa et al., 2009), ở Maiduguri của Nigeria là
4,3% (Sunday Akidarju Mamza et al., 2010), ở Nhật là 40,43% (Midori
Hiroi et al., 2012), ở Thụy Sĩ là 63,4% (Nadine Geser et al., 2012).
Bảng 3.1: Tỉ lệ lưu hành E. coli sinh ESBL trên gà theo tỉnh
Tỉnh
Vĩnh Long
Trà Vinh
Sóc Trăng
Hậu Giang
Tổng cộng

Số mẫu khảo sát (con)
590
550
450
450
2.040

Số mẫu dương tính (con)
389
378
298
200
1.265

Tỉ lệ (%)
65,93a
68,73a
66,22a
44,44b
62,01

Ghi chú: Các giá trị trong cùng một cột mang chữ mũ a, b khác nhau thì khác nhau có ý nghĩa thống kê (P<0,05).

3.1.2 Sự lƣu hành E. coli sinh ESBL trên gà theo quy mô chăn nuôi
Tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt (59,44%) và gà đẻ
(58,15%) nuôi ở quy mô hộ gia đình khác biệt không có ý nghĩa thống
kê (P=0,617). Ngược lại, tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt và
gà đẻ nuôi ở quy mô trang trại khác biệt có ý nghĩa thống kê (P=0,00)
trong đó tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt nuôi ở quy mô
trang trại (87,29%) cao hơn trên gà đẻ nuôi ở quy mô trang trại
(44,04%). Điều này cho thấy cùng quy mô chăn nuôi thì hình thức chăn
nuôi có ảnh hưởng đến tỉ lệ lưu hành E. coli sinh ESBL trên gà bởi vì
gà thịt nuôi ở quy mô trang trại có hình thức nuôi trên nền chuồng trong
khi gà đẻ nuôi ở quy mô trang trại có hình thức nuôi trên chuồng lồng
do đó gà thịt thường xuyên tiếp xúc trực tiếp với phân và chất lót
chuồng. Nhìn chung, tỉ lệ lưu hành E. coli sinh ESBL trên gà nuôi ở
quy mô trang trại (70,32%) cao hơn gà nuôi ở quy mô hộ gia đình
(58,89%) rất có ý nghĩa thống kê (P=0,00). Đặc biệt, gà thịt nuôi ở
trang trại và gà thịt nuôi ở hộ gia đình có cùng hình thức nuôi trên nền
chuồng nhưng tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt nuôi ở trang

11


trại (87,29%) cao hơn gà thịt nuôi ở hộ gia đình (59,44%) rất có ý nghĩa
thống kê (P=0,00). Kết quả nghiên cứu này có thể do ảnh hưởng của
quy mô chăn nuôi lên tỉ lệ lưu hành E. coli sinh ESBL trên gà.
Bảng 3.2: Tỉ lệ lưu hành E. coli sinh ESBL trên gà theo quy mô chăn nuôi
Quy mô
chăn nuôi
Hộ gia đình
(n=1.484)
Trang trại
(n=556)
Tổng

SMKS
(con)

Gà thịt
SMDT
(con)

SMKS
(con)

Gà đẻ
SMDT
(con)

858

510

59,44b

626

364

58,15a

874

58,89b

338

295

87,29a

218

96

44,04b

391

70,32a

1.196

805

59,44

844

460

54,50

1.265

62,01

Tỉ lệ
(%)

Tỉ lệ
(%)

Tổng
SMDT
Tỉ lệ
(con)
(%)

Ghi chú: SMKS là số mẫu khảo sát, SMDT là số mẫu dương tính. Các giá trị trong cùng một cột mang chữ mũ a, b khác nhau thì
khác nhau có ý nghĩa thống kê (P<0,05).

3.1.3 Sự lƣu hành của E. coli sinh ESBL trên gà thịt theo lứa tuổi
Bảng 3.3: Tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt theo lứa tuổi
Tuần tuổi
≤1
2-4
>4
Tổng

Số mẫu khảo sát (con)

Số mẫu dương tính (con)

464
467
265
1.196

301
316
188
805

Tỉ lệ (%)
64,87
67,67
70,94
67,31

Tỉ lệ lưu hành E. coli sinh ESBL trên gà thịt dưới 1 tuần tuổi, 2-4 tuần
tuổi và trên 4 tuần tuổi (Bảng 3.3) khác biệt không có ý nghĩa thống kê
(P=0,238). Điều này cho thấy sự lưu hành của E. coli sinh ESBL trên
gà không phụ thuộc theo lứa tuổi.
3.1.4 Sự lƣu hành của E. coli sinh ESBL trên trứng
Kết quả (Bảng 3.4) không phát hiện E. coli sinh ESBL ở vỏ trứng, lòng
đỏ và lòng trắng được thu thập từ gà đẻ ở trang trại. Đối với trứng gà
được thu thập từ gà đẻ nuôi ở hộ gia đình, E. coli sinh ESBL chỉ được
phát hiện trên vỏ trứng (4,8%).
Abubakar et al. (2016) đã phân lập E. coli sinh ESBL trên 70 trứng gà
ở Sokoto Metropolis của Nigeria. Kết quả cho thấy tỉ lệ trứng gà nhiễm
vi khuẩn E. coli sinh ESBL là 5,7% (4/70) trong đó có 4,2% (3/70) vỏ

12


trứng gà nhiễm E. coli sinh ESBL và 1,4% (1/70) hỗn hợp lòng đỏ và
lòng trắng trứng gà nhiễm E. coli sinh ESBL.
Bảng 3.4: Tỉ lệ lưu hành E. coli sinh ESBL ở mặt ngoài vỏ trứng
Quy mô chăn
nuôi
Hộ gia đình
Trang trại
Tổng

Số mẫu kiểm tra
(vỏ trứng)
200
50
250

Số mẫu dương
tính (vỏ trứng)
12
0
12

Tỉ lệ (%)
6,0
0,0
4,8

3.1.5 Sự lƣu hành E. coli sinh ESBL trong môi trƣờng chăn nuôi
Bảng 3.5: Tỉ lệ lưu hành E. coli sinh ESBL trong môi trường chăn nuôi
Loại mẫu
Nước sinh hoạt
Nước máng uống
Thức ăn máng ăn
Không khí

Quy mô chăn
nuôi

Số hộ/trại
khảo sát

Nông hộ
Trang trại
Hộ gia đình
Trang trại
Hộ gia đình
Trang trại
Hộ gia đình
Trang trại

60
20
60
20
60
20
60
20

Số hộ/trại
dương tính
3
1
27
6
15
6
12
11

Tỉ lệ (%)
5,0
5,0
45,0
30,0
25,0
30,0
20,0b
55,0a

Các giá trị trong cùng một cột mang chữ mũ a, b khác nhau thì khác nhau có ý nghĩa thống kê (P<0,05).

E. coli sinh ESBL được phát hiện trong nguồn nước sinh hoạt, nước
máng uống, thức ăn máng ăn, không khí chuồng nuôi, trong đó tỉ lệ
phát hiện E. coli sinh ESBL trong không khí ở quy mô chăn nuôi hộ gia
đình 20% thấp hơn ở quy mô chăn nuôi trang trại 55% (P=0,03).
3.1.6 Sự lƣu hành của E. coli sinh ESBL trên ngƣời chăn nuôi gà
Bảng 3.6: Tỉ lệ lưu hành của E. coli sinh ESBL trên người chăn nuôi gà
Quy mô chăn nuôi
Hộ gia đình
Trang trại
Tổng

Số mẫu khảo sát
(người)
60
20
80

Số mẫu dương
tính (người)
36
14
50

Tỉ lệ (%)
60,0
70,0
62,5

Tỉ lệ lưu hành E. coli sinh ESBL trên người chăn nuôi gà ở trang trại là
70% cao hơn trên người chăn nuôi gà ở hộ gia đình là 60%, tuy nhiên
sự khác biệt tỉ lệ này không có ý nghĩa thống kê (P=0,424). Sự hiện

13


diện của E. coli sinh ESBL trên người chăn nuôi cho thấy sự lưu hành
của E. coli sinh ESBL không chỉ trên gia súc gia cầm mà còn lưu hành
trên người đặc biệt là người tiếp xúc trực tiếp với động vật. Kết quả
nghiên cứu này không chỉ có ý nghĩa ở lĩnh vực thú y mà cả ở lĩnh vực
y tế để cùng phối hợp hoạt động giúp ngăn ngừa, giảm sự lây truyền vi
khuẩn đề kháng kháng sinh nhằm bảo vệ sức khỏe cho cộng đồng.
3.2 Sự lƣu hành của E. coli sinh ESBL tại cơ sở giết mổ
3.2.1 Kết quả phân lập E. coli sinh ESBL trên gà
Vi khuẩn E. coli sinh ESBL hiện diện trên gà từ 12 cơ sở giết mổ ở tỉnh
Vĩnh Long, Trà Vinh, Sóc Trăng và Hậu Giang với tỉ lệ dao động
42,22-53,33% (Bảng 3.7) và hiện diện trên các loại mẫu phổi, gan, thịt
và phân (Bảng 3.8).
Bảng 3.7: Tỉ lệ thân thịt gà dương tính với E. coli sinh ESBL
Tỉnh
Vĩnh Long
Trà Vinh
Sóc Trăng
Hậu Giang
Tổng

Số lượng thân thịt gà
khảo sát

Số lượng thân thịt gà
dương tính

Tỉ lệ (%)

45
45
45
45
180

23
24
21
19
87

51,11
53,33
46,67
42,22
48,33

Bảng 3.8: Tỉ lệ các loại mẫu dương tính với E. coli sinh ESBL
Loại mẫu

Số gà khảo sát (con)

Số gà dương tính (con)

Tỉ lệ (%)

Gan

180

09

5,0

Thịt

180

20

11,11

Phổi

180

21

11,67

Phân

180

87

48,33

Điều đáng quan tâm E. coli là một trong những vi khuẩn gây ngộ độc
thực phẩm và có khả năng sinh ESBL gây ra đề kháng kháng sinh do đó
thân thịt gà nhiễm E. coli sinh ESBL sẽ là nguồn chứa vi khuẩn gây
bệnh và đề kháng kháng sinh ảnh hưởng đến sức khỏe của người tiêu
dùng do thịt gà nằm trong chuỗi thức ăn của con người.

14


3.2.2 Kết quả phân lập E. coli sinh ESBL trên môi trƣờng giết mổ
Sàn pha lóc thịt, nước vặt lông và nước thải có sự lưu hành của E. coli
sinh ESBL trong đó sàn pha lóc thịt có tỉ lệ nhiễm E. coli sinh ESBL
cao 58,33%. Đây sẽ là một trong những nguồn chứa vi khuẩn để vấy
nhiễm lên thân thịt gà tại cơ sở giết mổ.
Bảng 3.9: Tỉ lệ các loại mẫu môi trường giết mổ dương tính với E. coli
sinh ESBL
Loại mẫu

Số mẫu khảo sát

Số mẫu dương tính

Tỉ lệ (%)

Không khí

12

0

0,00

Nguồn nước

12

0

0,00

Nước vặt lông

12

1

8,33b

Nước thải

12

2

16,67b

Sàn pha lóc

12

7

58,33a

Các giá trị trong cùng một cột mang chữ mũ a, b khác nhau thì khác nhau có ý nghĩa thống kê (P<0,05).

3.3 Sự đề kháng kháng sinh của E. coli sinh ESBL
3.3.1 Tính nhạy cảm kháng sinh của E. coli sinh ESBL phân lập từ
gà và ngƣời chăn nuôi
E. coli sinh ESBL phân lập từ gà đề kháng cao với ampicillin (98,87%),
cefuroxime (91,94%), cefaclor (92,69%) và trimethoprim/
sulfamethoxazole (81,24%). Tuy nhiên, các vi khuẩn này nhạy cảm cao
với amikacin (94,73%), fosfomycin (92,2%) và colistin (86,13%).
Riêng, E. coli sinh ESBL phân lập từ gà ở tỉnh Vĩnh Long còn nhạy
cảm cao với doxycycline (76,10%).
Tương tự, vi khuẩn E. coli sinh ESBL phân lập được từ người chăn
nuôi cũng có tính đề kháng cao với ampicillin (96,67%), cefuroxime
(100%), cefaclor (97,5%), trimethoprim/sulfamethoxazole và
streptomycin đồng tỉ lệ (75%) và nhạy cảm với amikacin (94,17%),
fosfomycin (96,67%), colistin (83,33%), doxycycline (70%),
norfloxacin (66,67%), ofloxacin (68,33%). Các loại kháng sinh và tỉ lệ
đề kháng của các chủng vi khuẩn phân lập từ gà và người chăn nuôi gần
giống nhau (Hình 3.1).

15


Bảng 3.10: Tỉ lệ E. coli sinh ESBL phân lập từ gà đề kháng kháng sinh

Am
Cu

Vĩnh Long
(n=502)
Tỉ lệ
+
(%)
493
98,21
431
85,86

Trà Vinh
(n=548)
Tỉ lệ
+
(%)
544
99,27
516
94,16

Sóc Trăng
(n=547)
Tỉ lệ
+
(%)
540
98,72
515
94,15

Hậu Giang
(n=263)
Tỉ lệ
+
(%)
262
99,62
248
94,30

Cr
Ge
Sm
Kn
Ak

450
237
376
246
12

89,64
47,21
74,90
49,00
2,39

493
350
454
351
11

89,96
63,87
82,85
64,05
2,01

528
457
283
367
52

96,53
83,55
51,74
68,34
9,51

253
175
246
183
6

96,20
66,54
93,54
69,58
2,28

1.724
1.219
1.359
1.118
81

Te
Dx
Nr
Of
Fos

199
26
157
139
36

39,64
5,18
31,27
27,69
7,17

378
108
207
191
16

68,98
19,71
37,77
34,85
2,92

399
236
318
268
48

72,94
43,14
58,14
48,99
8,78

227
64
98
79
6

86,31
24,33
37,26
30,04
2,28

1.203
434
780
677
106

64,68
23,33
41,94
36,40
5,70

Bt
Co

425
64

84,66
12,75

498
100

91,04
18,25

377
49

68,92
8,96

211
23

80,23
8,75

1.511
236

81,24
12,69

Kháng
sinh

Tổng (n=1.860)
+
1.839
1.710

Tỉ lệ
(%)
98,87
91,94
92,69
65,54
73,06
60,11
4,35

Ghi chú: Am: ampicillin; Cu: cefuroxime; Cr: cefaclor; Ge: gentamicin; Ak: amikacin; Sm: streptomycin; Kn: kanamycin; Te:
tetracycline; Dx: doxycycline; Nr: norfloxacin; Of: ofloxacin; Fos: fosfomycin; Co: colistin; Bt: trimethoprim+sulfamethoxazo le.,
(+): Số chủng đề kháng

Bảng 3.11: Tỉ lệ E. coli sinh ESBL phân lập từ gà nhạy cảm kháng sinh
Kháng
sinh
Am
Cu
Cr
Ge
Sm
Kn
Ak
Te
Dx
Nr
Of
Fos
Bt
Co

Vĩnh Long
(n=502)
Tỉ lệ
+
(%)
6
1,20
60
11,95
38
7,57
205
40,84
73
14,54
219
43,63
481
95,82
123
24,50
382
76,10
298
59,36
318
63,35
458
91,24
70
13,94
436
86,85

Trà Vinh
(n=548)
Tỉ lệ
+
(%)
0
0,00
14
2,55
37
6,75
159
29,01
62
11,31
182
33,21
531
97,07
66
12,04
234
42,70
315
57,48
207
37,77
512
93,43
41
7,50
446
81,39

Sóc Trăng
(n=547)
Tỉ lệ
+
(%)
5
0,91
8
1,46
12
2,19
47
8,59
94
17,18
134
24,95
492
89,95
58
10,60
222
40,59
182
33,27
234
42,78
491
89,76
129
23,58
497
90,86

Ghi chú: (+): Số chủng nhạy cảm

16

Hậu Giang
(n=263)
Tỉ lệ
+
(%)
5
0,91
8
1,46
12
2,19
47
8,59
94
17,18
134
24,95
492
89,95
58
10,60
222
40,59
182
33,27
234
42,78
491
89,76
129
23,58
497
90,86

Tổng (n=1.860)
+
12
87
92
485
340
656
1.762
265
954
918
887
1.715
283
1.602

Tỉ lệ
(%)
0,65
4,68
4,95
26,08
12,90
35,27
94,73
14,25
51,29
49,35
47,69
92,20
15,22
86,13


Bảng 3.12: Tỉ lệ E. coli sinh ESBL phân lập từ người chăn nuôi đề kháng với
kháng sinh
Kháng
sinh
Am
Cu
Cr
Ge
Sm
Kn
Ak
Te
Dx
Nr
Of
Fos
Bt
Co

Vĩnh Long
(n=33)

Trà Vinh
(n=25)

Sóc Trăng
(n=38)

Hậu Giang
(n=24)

Tổng (n=120)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

29
33
33
4
12
4
3
7
0
2
3
1
17
5

87,88
100
100
12,12
36,36
12,12
9,09
21,21
0,00
6,06
9,09
3,03
51,52
15,15

25
25
25
18
20
14
3
18
5
14
14
0
25
7

100
100
100
72,00
80,00
56,00
12,00
72,00
20,00
56,00
56,00
0,00
100
28,00

38
38
35
27
37
29
0
38
13
6
8
0
31
3

100
100
92,11
71,05
97,37
76,32
0,00
100
34,21
15,79
21,05
0,00
81,58
7,89

24
24
24
12
21
9
1
14
1
10
5
0
17
5

100
100
100
50,00
87,50
37,50
4,17
58,33
4,17
41,67
20,83
0,00
70,83
20,83

116
120
117
61
90
56
7
77
19
32
30
1
90
20

96,67
100
97,50
50,83
75,00
46,67
5,83
64,17
15,83
26,67
25,00
0,83
75,00
16,67

Ghi chú: (+): Số chủng đề kháng.

Bảng 3.13: Tỉ lệ E. coli sinh ESBL phân lập từ người chăn nuôi nhạy cảm với
kháng sinh
Kháng
sinh

Vĩnh Long
(n=33)
+

Am
Cu

1
0

Tỉ lệ
(%)
3,03
0,00

Trà Vinh
(n=25)
+
0
0

Tỉ lệ
(%)
0,00
0,00

Sóc Trăng
(n=38)
+
0
0

Tỉ lệ
(%)
0,00
0,00

Hậu Giang
(n=24)
+
0
0

Tỉ lệ
(%)
0,00
0,00

Tổng (n=120)
+
1
0

Tỉ lệ
(%)
0,83
0,00

Cr

0

0,00

0

0,00

2

5,26

0

0,00

2

1,67

Ge

27

81,82

5

20,00

10

26,32

11

45,83

53

44,17

Sm

14

42,42

4

16,00

0

0,00

0

0,00

18

15,00

Kn

27

81,82

9

36,00

9

23,68

14

58,33

59

49,17

Ak
Te
Dx

30
8
33

90,91
24,24
100

22
3
15

88,00
12,00
60,00

38
0
24

100
0,00
63,16

23
3
12

95,83
12,50
50,00

113
14
84

94,17
12,07
70,00

Nr

28

84,85

10

40,00

32

84,21

10

41,67

80

66,67

Of

30

90,91

10

40,00

30

78,95

12

50,00

82

68,33

Fos

30

90,91

25

100

38

100

23

95,83

116

96,67

Bt

16

48,48

0

0,00

5

13,16

3

12,50

24

20,00

Co

28

84,85

18

72,00

35

92,11

19

79,17

100

83,33

Ghi chú: (+): Số chủng nhạy cảm

17


120
Tỉ lệ (%)



Người chăn nuôi

100

80

60

40

20

0
Am Cu

Cr

Ge

Sm Kn Ak Te Dx
Kháng sinh

Nr

Of Fos

Bt

Co

Hình 3.1: So sánh tỉ lệ đề kháng kháng sinh của E. coli sinh ESBL phân lập từ
gà và người chăn nuôi

3.3.2 Tính đa kháng thuốc kháng sinh của E. coli sinh ESBL
Bảng 3.14: Tỉ lệ E. coli sinh ESBL phân lập từ gà đa kháng kháng sinh
Vĩnh Long
(n=502)

Trà Vinh
(n=548)

Sóc Trăng
(n=547)

Hậu Giang
(n=263)

Tổng
(n=1.860)

Số
kháng
sinh bị
kháng

+

1

11

2,19

0

0,00

0

0,00

0

0,00

11

0,59

2

16

3,19

8

1,46

0

0,00

0

0,00

24

1,29

3

33

6,57

24

4,38

5

0,91

5

1,90

67

3,60

4
5
6

35
78
82

6,97
15,54
16,33

26
34
72

4,74
6,20
13,14

18
43
27

3,29
7,86
4,94

13
26
25

4,94
9,89
9,51

92
181
206

4,95
9,73
11,08

7

79

15,74

85

15,51

64

11,70

19

7,22

247

13,28

8

75

14,94

102

18,61

110

20,11

55

20,91

342

18,39

9

44

8,76

79

14,42

114

20,84

71

27,00

308

16,56

10

42

8,37

57

10,40

120

21,94

37

14,07

256

13,76

11

6

1,20

29

5,29

36

6,58

7

2,66

78

4,19

12

1

0,20

31

5,66

8

1,46

4

1,52

44

2,37

13

0

0,00

1

0,18

1

0,18

1

0,38

3

0,16

14

0

0,00

0

0,00

1

0,18

0

0,00

1

0,05

Tỉ lệ
(%)

Tỉ lệ
(%)

+

Tỉ lệ
(%)

+

18

+

Tỉ lệ
(%)

Tỉ lệ
(%)

+


Bảng 3.15: Tỉ lệ E. coli sinh ESBL phân lập từ người chăn nuôi gà đa kháng
kháng sinh
Số
kháng
sinh bị
đề
kháng
3
4
5
6
7
8
9
10
11
12
13

Vĩnh Long
(n=33)

Sóc Trăng
(n=38)

Trà Vinh
(n=25)

Hậu Giang
(n=24)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

+

Tỉ lệ
(%)

19
1
3
2
4
1
1
2
0
0
0

57,58
3,03
9,09
6,06
12,12
3,03
3,03
6,06
0,00
0,00
0,00

0
3
0
0
0
12
3
3
1
2
1

0,00
12,00
0,00
0,00
0,00
48,00
12,00
12,00
4,00
8,00
4,00

0
1
2
4
4
11
11
5
0
0
0

0,00
2,63
5,26
10,53
10,53
28,95
28,95
13,16
0,00
0,00
0,00

+
3
0
3
4
5
3
2
3
0
1
0

Tổng (n=120)

Tỉ lệ
(%)

+

Tỉ lệ
(%)

12,50
0,00
12,50
16,67
20,83
12,50
8,33
12,50
0,00
4,17
0,00

22
5
8
10
13
27
17
13
1
3
1

18,33
4,17
6,67
8,33
10,83
22,50
14,17
10,83
0,83
2,50
0,83

Đề kháng 3-4 loại kháng sinh

Đề kháng 1-4 loại kháng sinh

6,77%

Đề kháng 5-10 loại kháng sinh

4,17%

10,43%

Đề kháng 11-13 loại kháng sinh

Đề kháng 5-10 loại kháng sinh

22,50%

Đề kháng 11-14 loại kháng sinh

73,33%

82,80%

(a)

(b)

Hình 3.2: Sự phân bố đa kháng thuốc kháng sinh trên gà (a) và trên người chăn
nuôi gà (b)

Kết quả phân tích tính đa kháng của các chủng E. coli sinh ESBL phân
lập từ gà cho thấy vi khuẩn E. coli sinh ESBL kháng từ 1-14 loại kháng
sinh trong đó đa kháng 5 đến 10 loại kháng sinh chiếm tỉ lệ cao 82,80%
(Bảng 3.14, Hình 3.2a), có 359 kiểu hình đa kháng. Các chủng vi khuẩn
E. coli sinh ESBL phân lập từ người chăn nuôi gà đa kháng từ 3-13 loại
kháng sinh trong đó đa kháng từ 5-10 loại kháng sinh cũng chiếm phổ
biến 73,33% (Bảng 3.15, Hình 3.2b), có 40 kiểu hình đa kháng.

19


Tính đề kháng kháng sinh của vi khuẩn E. coli sinh ESBL phân lập từ
gà cao hơn tính đề kháng kháng sinh của vi khuẩn E. coli sinh ESBL
phân lập từ người chăn nuôi gà. Tính đề kháng kháng sinh của vi khuẩn
E. coli sinh ESBL phân lập từ gà và người chăn nuôi gà ở tỉnh Sóc
Trăng cao hơn tính đề kháng kháng sinh của vi khuẩn E. coli sinh
ESBL phân lập từ gà và người chăn nuôi gà ở các tỉnh Vĩnh Long, Trà
Vinh và Hậu Giang.
3.4 Kết quả xác định các gen CTX-M, TEM và SHV
Các gen TEM, SHV và CTX-M hiện diện trên E. coli sinh ESBL phân
lập từ các loại mẫu ở khu vực chăn nuôi gà và cơ sở giết mổ. Các gen
TEM, CTX-M được phát hiện với tỉ lệ cao hơn so với gen SHV. Các
gen này có thể tồn tại độc lập hoặc cùng tồn tại trên một E. coli sinh
ESBL tạo ra 7 kiểu lưu hành các gen TEM, SHV và CTX-M trên vi
khuẩn E. coli sinh ESBL phân lập từ gà và 3 kiểu lưu hành gen TEM,
SHV và CTX-M trên E. coli sinh ESBL phân lập từ người chăn nuôi
gà, trong đó sự lưu hành của 3 gen này trên một vi khuẩn E. coli sinh
ESBL chiếm ưu thế, kế đến là sự kết hợp của 2 gen TEM và CTX-M
trên một vi khuẩn E. coli sinh ESBL, sự lưu hành riêng lẻ các gen hay
kết hợp gen CTX-M và SHV, hoặc TEM và SHV chiếm tỉ lệ thấp. Dựa
vào kết quả xác định các gen TEM, SHV, CTX-M và phân tích tính
nhạy cảm, đa kháng thuốc kháng sinh ở mục 3.3 càng cho thấy khả
năng đề kháng kháng sinh của E. coli sinh ESBL càng cao, điều này sẽ
gây khó khăn cho công tác điều trị bệnh bằng kháng sinh, nhất là giải
thích được vì sao vi khuẩn có thể đa kháng được nhiều loại kháng sinh.
Bảng 3.16: Sự phân bố các gen CTX-M, TEM và SHV trên E. coli sinh ESBL
phân lập từ các loại mẫu
Gen
TEM

Số chủng E. coli sinh ESBL (n=631)
Số chủng dương tính
Tỉ lệ dương tính (%)
544
86,21a

CTX-M

531

84,15a

SHV

345

54,68b

14

2,22c

Không phát hiện*

* Không phát hiện cả ba gen TEM, CTX-M và SHV. Các giá trị trong cùng một cột mang chữ mũ khác nhau thì khác nhau có ý
nghĩa thống kê (P<0,05)

20


Bảng 3.17: Sự phân bố gen CTX-M, TEM và SHV trên E. coli sinh ESBL
phân lập từ gà ở hộ và trại chăn nuôi
Số mẫu dương tính (Tỉ lệ %)
Gen

Vĩnh Long
(n=173)
134 (77,46)
127 (73,41)
55 (31,79)
8 (4,62)

CTX-M
TEM
SHV
Không phát hiện

Trà Vinh
(n=61)
45 (73,77)
51 (83,61)
44 (72,13)
3 (4,92)

Sóc Trăng
(n=122)
121 (99,18)
110 (90,16)
43 (35,25)
0

Hậu Giang
(n=132)
112 (84,85)
117 (88,64)
98 (74,24)
3 (2,27)

Tổng
(n=488)
412 (84,43)
405 (82,99)
240 (49,18)
14 (2,87)

Bảng 3.18: Sự phân bố gen CTX-M, TEM và SHV trên E. coli sinh ESBL
phân lập từ người chăn nuôi gà
Vĩnh Long
(n=5)
5 (100)
5 (100)
4 (80,0)

Gen
CTX
TEM
SHV

Số mẫu dương tính (Tỉ lệ %)
Trà Vinh
Sóc Trăng
Hậu Giang
(n=4)
(n=6)
(n=6)
2 (50,0)
6 (100)
6 (100)
4 (100)
6 (100)
6 (100)
4 (100)
5 (83,3)
5 (83,3)

Tổng (n=21)
19 (90,5)
21 (100)
18 (85,7)

Bảng 3.19: Sự phân bố gen CTX-M, TEM và SHV trên E. coli sinh ESBL
phân lập từ vỏ trứng và môi trường chăn nuôi
Gen

Trứng (n=12)

CTX
TEM
SHV

12 (100)
12 (100)
7 (58,3)

Số mẫu dương tính (Tỉ lệ %)
Thức ăn
Nước máng
máng ăn
uống (n=24)
(n=19)
3 (100)
16 (66,7)
14 (73,7)
3 (100)
21 (87,5)
16 (84,2)
2 (66,7)
18 (75,0)
14 (73,7)

Nguồn nước
(n=3)

Không khí
(n=14)
10 (71,4)
14 (100)
7 (50,0)

Bảng 3.20: Sự phân bố gen CTX-M, TEM và SHV trên E. coli sinh ESBL
phân lập từ gà và môi trường tại cơ sở giết mổ
Gen



CTX-M
TEM
SHV

(n=40)

12 (100)
12 (100)
7 (58,3)

Số mẫu dương tính (Tỉ lệ %)
Sàn pha lóc
Nước vặt lông
(n=7)
(n=1)
3 (100)
16 (66,7)
3 (100)
21 (87,5)
2 (66,7)
18 (75,0)

Nước thải (n=2)
14 (73,7)
16 (84,2)
14 (73,7)

Bảng 3.21: Các kiểu hiện diện gen CTX-M, TEM và SHV trên E. coli sinh
ESBL phân lập từ gà
Gen

Vĩnh Long
(n=173)

CTX-M
TEM
SHV
CTX-M, SHV
CTX-M, TEM
TEM, SHV
CTX-M, TEM, SHV

31 (17,92)
13 (7,51)
4 (2,31)
3 (1,73)
65 (37,57)
12 (6,94)
37 (21,38)

Số mẫu dương tính (Tỉ lệ %)
Hậu
Trà Vinh
Sóc Trăng
Giang
(n=61)
(n=122)
(n=132)
6 (9,83)
1 (0,82)
4 (3,03)
2 (3,27)
0
7 (5,30)
0
6 (4,92)
4 (3,03)
1 (1,64)
1 (0,82)
4 (3,03)
7 (11,47)
73 (59,83)
20 (15,15)
12 (19,67)
1 (0,82)
6 (4,55)
30 (49,18)
40 (32,78)
84 (63,63)

21

Tổng
(n=488)
42 (8,61)
22 (4,51)
14 (2,86)
9 (1,84)
165 (33,81)
31 (6,35)
191 (39,14)


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×