Tải bản đầy đủ

Khảo sát vi khuẩn escherichia coli sinh beta lactamase phổ rộng trên gà tại một số trại chăn nuôi ở đồng bằng sông cửu long

MINISTRY OF EDUCATION AND TRAINING
CAN THO UNIVERSITY

SUMMARY OF DOCTORAL DISSERTATION
Major: Veterinary Pathology and Treatment
Code: 62 64 01 02

BUI THI LE MINH

INVESTIGATION OF EXTENDED SPECTRUM
BETA-LACTAMASE PRODUCING
ESCHERICHIA COLI IN CHICKENS
IN THE MEKONG DELTA

Can Tho, 2018


THE DISSERTATION WAS COMPLETED
AT CAN THO UNIVERSITY

Supervisor: Assoc. Prof. Dr. Luu Huu Manh


The dissertation is defended in front of the University Examination
Council in Can Tho University
Place: ……………………….……, Can Tho University
Time: ……………………………….

Reviewer 1: ………………………………
Reviewer 2: ………………………………
Reviewer 3: ………………………………

Further information of the dissertation could be found at:
Learning Resource Center of Can Tho University
National Library of Vietnam.


THE LIST OF PUBLISHED WORKS RELATED TO
THIS DISSERTATION
A. Published papers
1. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Investigation on the presence of Escherichia coli producing extendedspectrum β-lactamase isolated from healthy chicken in Vinh Long
province. Veterinary Sciences and Techniques, 2: 22-27.
2. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Investigation on CTX-M, TEM and SHV genes in extended-spectrum
β-lactamase producing Escherichia coli from chickens in Tra Vinh
province. Journal of Science, Can Tho University, 42(b): 1-6.
3. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Study on extended-spectrum β-lactamase producing Escherichia coli on
chickens from slaughterhouses in Vinh Long province. Journal of
Science, Can Tho University, special issue 2: 1-5.
4. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Prevalence of extended-spectrum β-lactamase producing Escherichia
coli on sick chickens in Vinh Long province. Journal of Science, Can
Tho University, special issue 2: 6-10.
5. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.
Study of extended spectrum beta-lactamase producing Escherichia coli
isolated from sick chickens in Hau Giang province. Proceeding of The
19th Federation of Asian Veterinary Associations Congress, September
6-9th 2016, Ho Chi Minh city. Vietnam National University-Ho Chi
Minh city Press, 148-150.
6. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2016.


Occurrence of extended spectrum beta-lactamase producing
Escherichia coli in chickens from slaughter houses in the Mekong delta
of Vietnam. Proceedings international conference on agriculture


development in the context of international integration: Opportunities
and challenges, December 7-8th 2016, Ha Noi. Agriculture University
Press, 198-202.
7. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2017.
Occurrence of TEM, SHV and CTX-M genes in diarrhea chickens and
antibiotic resistance. Proceeding of 33th World Veterinary Congress,
August 27-31 2017, Incheon-Korea.
8. Bui Thi Le Minh, Luu Huu Manh, Nguyen Nhut Xuan Dung, 2018.
Prevalence of extended-spectrum beta-lactamase-producing Escherichia
coli on chicken rearer in the Mekong Delta. Journal of Science, Can
Tho University, special issue 54: 1-5.
B. Scientific research has been accepted
1. Bui Thi Le Minh (Coordinator). Investigation of extended-spectrum
beta-lactamase producing Escherichia coli in chickens and antibiotic
susceptibility testing. Scientific research project grant Can Tho
University, 2015, code number T2015 -62.
2. Bui Thi Le Minh (Coordinator). Investigation on bla CTX-M, bla
TEM and bla SHV genes in extended-spectrum beta-lactamase
producing Escherichia coli isolated from sick chickens in Vinh Long
province. Scientific research project grant Can Tho University, 2016,
code number T2016 -52.
3. Bui Thi Le Minh (Coordinator). Investigation on TEM, SHV and
CTX-M genes in extended-spectrum beta-lactamase producing
Escherichia coli isolated from chicken farmers in the Mekong Delta.
Scientific research project grant Can Tho University, 2017, code
number T2017-50.


CHAPTER 1: INTRODUCTION
1.1 Necessity of thesis
Colibacillosis is one of common infectious bacterial diseases of the
broiler and layer industry (Raji et al., 2003). E. coli are always found in
the gastrointestinal of chickens and disseminated widely in faeces;
therefore chickens are continuously exposed through contaminated
faeces, water, dust and the environment. E. coli infection can result in
several localized and systemic forms such as vaginitis, orchitis, yolk
sac infection, diarrhea enteritis, meningitis, panophthalmitis, arthritis,
respiratitis. Colibacillosis can break out all chicken ages and cause high
mortibity and morbility leading to economic losses on farmers (Barnes
et al., 2008). Nowadays, using of antibiotics in feed, water frequently to
prevent and treat diseases as well as improve growth of animals will
result in selection depression of bacteria, exhibition of multi-resistance
bacteria; therefore effects of antibiotic treatment will be slow (Linder,
2015). In recent years, antibiotic resistant bacteria has increased and
antibiotic resistance is an notice issue to research deeply in the world,
especially extended spectrum beta-lactamase producing E. coli (ESBL
producing E. coli). Because ESBL producing E. coli not only destroy
most of beta-lactames but also multiresistant to other antibiotics
including aminoglycoside, macrolide, chloramphenicol, tetracycline
and fluoroquinolone (Lee, 2006).
Several studies on ESBL producing E. coli in humans and animals were
carried out in many countries in the world and some papers were
published. For example, Blanc et al. (2006) determined the presence of
ESBL producing E. coli in chickens Catalonia, Spain 59.8%. In
Belgium, Smet et al. (2008) determined the occurrence of ESBL
producing E. coli in healthy 5 week old chickens 45%. The study of
Costa et al. (2009) on 76 chicken meat samples at slaughterhouses in
South of Portugal the presence of ESBL producing E. coli 38.2%.
Mamza et al. (2010) studied on chickens in Maiduguri, Nigeria; the

1


results showed that the presence of E. coli in healthy chickens 4.3%
(25/582), sick chickens 28.7% (64/223), the presence of ESBL
producing E. coli in chickens 11.1% (89/805). The study of Overdevest
et al. (2011) in Netherlands in 2009 showed 79.8% (68/89) chicken
meat samples at stores were positive for ESBL producing E. coli and
74.2% (23/31) patients from 4 hospitals were positive for ESBL
producing E. coli.
In Vietnam, some studies of ESBL producing E. coli on animals,
animal food and environment were published: Van Thi Thu Hao et al.
(2008) investigated the presence of ESBL producing E. coli in 30
chicken meat samples, 50 pork samples collected from markets and
supermarkets around Ho Chi Minh City, 43 fecal samples of one month
old chickens, the results showed that the occurrence of ESBL producing
E. coli in chicken meat samples, pork samples and fecal samples of
chickens were 89.5%, 75% and 95%, respectively. Vo Thanh Thin et
al. (2011) studied on beta-lactam resistant genes in E. coli isolated from
diarrhea piglets in the South Central Coast Region and Western
Highlands of Vietnam; the results showed 115/184 E. coli isolates
produced at least one beta-lactamase type, beta-lactamases were
encoded by TEM (61.96%) and SHV (0.54%). The results of Bui Thị
Ba et al. (2012) on E. coli isolated from healthy cattle in the South
Central Coast Region of Vietnam showed 64.70% (22/34) E. coli
isolates produced at least one beta-lactamase type, beta-lactamases
were encoded by TEM (64.70%) and SHV (11.76%). Ho Thi Kim Hoa
et al. (2013) studied on 45 waste samples (15 fresh wastewater samples,
15 biogas wastewater samples and 15 chicken fecal samples); the
results shoewed that the prevalence of TEM, SHV genes encoding
extended spectrum beta-lactamase were 82.22% (37/45) and 8.89%
(4/45) respectively and CTX-M gene was not detected.
The results of Vietnam and the world showed ESBL producing E. coli
were not only found in animals but also in farmers, animal food and

2


environment. Poultry husbandry of the Mekong Delta developed the
industry chicken husbandry and the local chicken husbandry. Chicken
diseases, especially ESBL producing E. coli, in the Mekong Delta were
issues of concern for farmers and scientists bacause they were found in
a lot of sample types and were multiresistant to antibiotics. However,
the information of ESBL producing E. coli were limited. Therefore, this
study was carried out to investigate of the occurrence of ESBL
producing E. coli in chickens, risk factors and antibiotic resistant
situation of them to have primary scientific data for studies in the future
and to prevent colibacillosis in chickens effectively and to minimise
transmission of antibiotic resistant bacteria from animal husbandry to
humans.
1.2 Objectives of research
- Determination of the occurrence of ESBL producing E. coli on
chickens in households and industrial farms, risk factors including eggs,
chicken rearers, chicken meat in slaughterhouses and environmental
factors in households, farms and slaughterhouses in some provinces of
the Mekong Delta.
- Determination of ESBL producing E. coli resistance to common used
antibiotics for chickens.
- Evaluation of the genetic correlation of CTX-M and TEM genes in
ESBL producing E. coli isolated from chickens, eggs, chicken rearers
and husbandry environment.
1.3 Innovativeness
- The results have detemined the high occurrence of ESBL producing
E. coli on chickens in households and industrial farms. Risk factors
including eggs, chicken rearers, chicken meat in slaughterhouses and
environmental factors in households, farms and slaughterhouses were
also found the occurrence of ESBL producing E. coli.

3


- ESBL producing E. coli isolated from chickens were highly
susceptible to aminkacin, fosformycin and colistin.
- The results of the dissertation have confirmed the genetic
homologeneity of CTX-M and TEM genes in ESBL producing E. coli
isolated from chickens, eggs, chicken rearers and husbandry
environment.
CHAPTER 2: MATERIALS AND METHODS
2.1 Contents of research
The study was conducted contents of research:
Content 1: Survey on the occurrence of ESBL producing E. coli on
chickens in households and industrial farms, eggs, chicken meats in
slaughterhouses, chicken rearers and some factors in husbandry region
and slaughterhouses.
The aim was to determine the prevalence of ESBL producing E. coli on
each subject of research to find the occurrence of them on chickens and
risk factors.
Content 2: Investigate in antibiotic resistance of ESBL producing
E. coli to some antibiotics including beta-lactam and antibiotics
commonly used in chickens.
The aim was to find available antibiotics for ESBL producing E. coli
and to help for the effective prevention and treatment of collibacillosis.
Content 3: Analysis of nucleotide sequences of some genes encoding
extended-spectrum beta-lactamases and contruction of phylogenetic
trees.
Determination of CTX-M and TEM genes encoding extended-spectrum
beta-lactamases, analysis of nucleotide sequences of them and
contruction of phylogenetic trees. The aim was to confirm the genetic
homologeneity of them in ESBL producing E. coli isolated from
chickens, eggs, husbandry environment and chicken rearers, to prevent
transmission of antibiotic resistant bacteria in chicken husbandry as

4


well as transmission of antibiotic resistant bacteria from animals to
humans and to protect public health.
The study time: from 2014 to 2017.
The location of sampling: in 304 housholds and 104 industrial chicken
farms, 12 slaughterhouses in the Mekong delta including Vinh Long,
Tra Vinh, Soc Trang and Hau Giang provinces.
The location of testing: isolation and identification of bacteria,
antimicrobial susceptibility test and PCR reactions were carried out in
Can Tho University, analyzing nucleotide sequences in Macrogen
company, Korea.
2.2 Materials
The essential items including freezer, autoclave, dryer oven, incubator,
vortex, UV-VIS spectrophotometer, PCR system.
Medium and chemical for incubation, isolation and identification of
E. coli; antibiotic paper disks; chemical using for PCR, analyzing genes.
2.2 Methods
2.2.1 Sampling methods
Samples were collected from 2 areas including husbandry regions and
slaughterhouses. In husbandry regions, the samples were collected from
households (50-180 chickens/household) and industrial farms (6.00014.000 chickens/farm).

The total of 304 households and 104 farms were investigated. Eighty
households and farms (60 households and 20 farms) were collected egg,
chicken, chicken rearer, and husbandry environment samples (including
domestic water, feed and water in trough, air) to analyze the genetic
correlation of CTX-M and TEM genes.
Besides, 12 slaughterhouses were examined. At slaughterhouses,
chicken and environment samples (domestic water, removing feather
water, waste water, floor, air) were selected.

5


The samples were collected from Vinh long province (Binh Minh, Binh
Tan, Mang Thit, Tra On, Tam Binh, Long Ho districts), Tra Vinh
province (Tra Vinh, Tieu Can, Cang Long, Cau Ke, Cau Ngang, Chau
Thanh districts), Soc Trang province (Ke Sach, Chau Thanh, Long Phu,
Tran Đe, Nga Nam, Vinh Chau, Long Phu, My Tu districts) and Hau
Giang province (Vi Thanh, Vi Thuy, Chau Thanh, Phung Hiep, Nga
Bay districts).
2.2.1.1 The number of collected samples in households and farms

Total of collected chickens in each province were calculated
according to Cannon and Reo (1982), estimation of disease
prevalence using simple random sampling method:
n= Z2*P*(1- P)/d2
n: required sample size, P: expected prevalence, d: desired absolute
precision. With 95% level of confidence, P=50% and d=5%, total of
samples in each provine were at least 384 chickens.
2,040 healthy chickens and diarrhea chickens were collected in 4
provinces. Healthy chickens were collected fecal swabs from cloacae.
Each diarrhea chicken was collected 4 samples including lung, liver,
meat and feces.
Table 3.1: The number of collected chickens according to husbandry methods
Husbandry methods
Subjects of research

Total
Households

Farms

Broilers

858

338

1.196

Layers

626

218

844

Eggs

200

50

250

Chicken rearers

60

20

80

Husbandry environment
(household or farm)

60

20

80

6


Table 3.2: The number of samples collected in households and farms
Subjects of research
Healthy chickens (n=1.640)
Diarrhea chickens (n= 400)

Eggs (n=250)
Chicken rearers (n=80)
Husbandry environment (n=80 households/farms)

Samples
Feces
Feces
Lung
Liver
Meat
Egg shell
Egg yolk
Egg white
Feces
Air
Feed in trough
Domestic water
Water in trough

Total
1.640
400
400
400
400
250
250
250
80
400
80
80
80
4,710

Total

Table 3.3: The number of chickens collected according to the aim of
production and the age
The aim of production

Broilers

≤ 1 week
2-4 week
> 4 week
Total

Layers
Total

Vinh
Long
119
117
100
336
254
590

Tra Vinh
115
115
55
285
265
550

Soc Trang

Hau Giang

115
120
55
290
160
450

115
115
55
285
165
450

Total
464
467
265
1,196
844
2,040

2.2.1.2 The number of collected samples at slaughterhouses
Table 3.4: The number of collected samples in slaughterhouses
Subjects of research

Chickens (n=180)

Slaughterhouse environment
(n=12 slaughterhouses)

Samples
Feces
Lung
Liver
Meat
Air
Floor
Domestic water
Removing feather
water
Waste water

Total

7

Total
180
180
180
180
60
12
12
12
12
828


The number of chickens were collected at slaughterhouses according to
National technical regulation: Methods for sampling and storing of
fresh meat from slaughterhouses and business establishments for
microbiological analysis (QCVN 01-04:2009/BNNPTNT). Fifteen
chickens were collected at a slaughterhouse for one time. The total of
180 chickens were collected from 12 slaughterhouses. Each chicken
was collected 4 samples including meat, liver, lung and feces.
2.3.2 Isolation and identification of ESBL producing E. coli
Isolation and identification of ESBL producing E. coli had two steps
including initial screening and phenotypic confirmatory tests for
extended spectrum beta-lactamases. Initial screening test for ESBL
producing E. coli was carried out on MacConkey Agar suppling 2mg/l
ceftazidime (David and Bonomo, 2005) and phenotypic confirmatory
tests for ESBL by combination disc method (CLSI, 2014). Biochemical
reaction tests of E. coli (Mac Faddin, 2000).
2.3.3 Antimicrobial susceptibility test of ESBL producing E. coli
Each positive sample was sellected from 1 to 3 ESBL producing E. coli
isolates to examine susceptibility of isolates to antibiotics. Total of
1,860 ESBL producing E. coli isolated from chickens and 120 ESBL
producing E. coli isolated from chicken rearers were tested sensitivity
to 14 antibiotics. Antimicrobial susceptibility test of ESBL producing
E. coli was conducted by disc diffusion test of Kirbry-Bauer et al.
(1966) according to CLSI guidelines 2014.
2.3.4 Determination of CTX-M, TEM and SHV genes
The number of 631 ESBL producing E. coli from 631 positive samples
were determined CTX-M, TEM and SHV genes by PCR method.
DNA samples of ESBL producing E. coli were extracted by
temperature shock method according to Costa et al. (2010). The
primers were used in this study according to Rasheed et al. (2000),
Gniadkowshi et al. (1998) và Bonnet et al. (2000).

8


Table 3.5: The number of ESBL producing E. coli isolates were determined
antibiotic resistant genes
Location

Households and farms

Slaughterhouses

Subjects of research

ESBL producing E. coli
isolates

Chickens
Chicken rearers
Egg shell
Husbandry environment
Chickens
Slaughterhouse environment

488
21
12
60
40
10
631

Total

Table 3.6: The primers were used in the study
Gene
TEM-F
TEM-R
SHV-F
SHV-R
CTX-MF
CTX-MR

Primers
ATGAGTATTCAACATTTCCG
TTACTGTCATGCCATCC
ACTGAATGAGGCGCTTCC
ATCCCGCAGATAAATCACC
CGCTTTGCGATGTGCAG
ACCGCGATATCGTTGGT

bp

References

351

Rasheed et al., 2000

297

Gniadkowshi et al., 1998

550

Bonnet et al., 2000

2.3.5 Analyzing nucleotide sequences of TEM and CTX-M genes
and building phylogenetic trees
17 samples contain CTX-M genes and 17 samples contain TEM genes
were analyzed nucleotide sequences of reverse and forever primers in
Macrogen company, Korea.
Nucleotide sequences of TEM and CTX-M genes were compared the
genetic correlation to CTX-M and TEM genes encoding ESBL on
National Center for Biotechnology Information (NCBI), USA by
nucleotide Blast method. Nucleotide and amino acid correlation level of
samples were analyzed by BioEdit software. Mega 6.0 software was
used to construct the phylogenetic trees by Maximum-likelihood
method.
2.3.6 Observed parameters
The proportion of chickens, eggs, farmers, environmental factors of
farms and slaughterhouses was positive ESBL producing E. coli.

9


The rate of ESBL producing E. coli isolated from chickens and farmers
was sensitive and resistant to antibiotics.
The rate of ESBL producing E. coli isolated from chickens and farmers
was multiresistant to antibiotics
The prevalence of TEM, SHV, CTX-M genes in chickens, egg, farmer,
environmental factors of farmers and slaughterhouses.
Correlation level of CTX-M and TEM genes in ESBL producing E. coli
isolated from chickens, eggs, farmers, and environmental factors.
The percentage (%) was calculated:
R=Total of positive samples*100/ Total of tested samples
2.3.7 Statistical analysis
Differences of the rate were analyzed by Chi-square test. Statistical
analysis used Minitab version 16.0 software.
CHAPTER 3: RESULTS AND DISCUSSIONS
3.1 The occurrence of ESBL producing E. coli in households and
industrial farms
3.1.1 The occurrence of ESBL producing E. coli in chickens
according to location
The results showed that the prevalence of ESBL producing E. coli in
chickens in the Mekong delta was 62.01%. The prevalence of ESBL
producing E. coli on chickens in Hau Giang (44.44%) was slower than
on chickens in Vinh Long (65.93%), Tra Vinh (68.73%) and Soc Trang
(66.22%) significantly (P = 0.00).
Some results in the world showed that the rate of chickens was positive
ESBL producing E. coli in Belgium 45% (Annemieke Smet et al.,
2008), in Portugal 38.2% (Daniela Costa et al., 2009), in Maiduguri of
Nigeria 4.3% (Sunday Akidarju Mamza et al., 2010), in Japan 40.43%
(Midori Hiroi et al., 2012), in Switzerland 63.4% (Nadine Geser et al.,
2012).

10


Table 3.1: The rate of ESBL producing E. coli positive chickens
The number of tested
The number of positive
Location
samples (chicken)
samples (chicken)
Vinh Long
590
389
Tra Vinh
550
378
Soc Trang
450
298
Hau Giang
450
200
Total
2,040
1.265

%
65.93a
68.73a
66.22a
44.44b
62.01

Notice: The values in the same column with a,b different digits are different highly statistically
significant (P<0.05).

3.1.2 The occurrence of ESBL producing E. coli in chickens
according to husbandry methods
The results in Table 3.2 showed the prevalence of ESBL producing
E. coli in chickens of households 58.89% was slower than in chickens
of industrial farms 70.32% (P=0,00). In households, the prevalence of
ESBL producing E. coli in broilers and layers was not different
significantly while in industrial farms the prevalence of ESBL
producing E. coli in broilers 87.29% was higher than in layers 44.04%
(P=0.00).
Table 3.2: The rate of ESBL producing E. coli positive chickens
according to husbandry methods
Husbandry
methods
Households
(n=1,484)
Farms
(n=556)
Total

SMKS

Broilers
SMDT

SMKS

Layers
SMDT

858

510

59.44b

626

364

58.15a

874

58.89b

338

295

87.29a

218

96

44.04b

391

70.32a

1,196

805

59.44

844

460

54.50

1,265

62.01

%

%

Total
SMDT
%

Notice: SMKS: the number of tested samples, SMDT: the number of positive samples. The values
in the same column with a,b different digits are different highly statistically significant (P<0.05).

3.1.3 The occurrence of ESBL producing E. coli in chickens
according to the age
The results of ESBL producing E. coli isolation in ≤ 1 week of age, 2-4
week of age and >4 week of age (Table 3.3) showed there was not
difference the prevalence of ESBL producing E. coli in all ages of
broilers (P=0.238).

11


Table 3.3: The rate of ESBL producing E. coli positive broilers
according to the age
Week of
age
≤1
2-4
>4
Total

The number of tested
samples (broiler)
464
467
265
1,196

The number of positive
samples (broiler)
301
316
188
805

%
64.87
67.67
70.94
67.31

3.1.4 The occurrence of ESBL producing E. coli in eggs
The results of study (Table 3.4) did not detect ESBL producing E. coli
in egg shell, egg white and egg yolk collected from layers in industrial
farm. For eggs collected from layers in households, ESBL producing
E. coli were not found in egg white and egg yolk but they were detected
in egg shell (4.8%).
Abubakar et al. (2016) isolated ESBL producing E. coli in 70 chicken
eggs in Sokoto Metropolis of Nigeria. The results showed that the
occurrence of ESBL producing E. coli in eggs was 5.7% (4/70). ESBL
producing E. coli were detected in egg shell 4.2% (3/70) and in mix of
egg white and egg yolk 1.4% (1/70).
Table 3.4: The rate of egg shell was infected ESBL producing E. coli
Husbandry
method
Households

The number of tested
samples (egg shell)

The number of positive
samples (egg shell)

%

200

12

6.0

Farms

50

0

0.0

Total

250

12

4.8

3.1.5 The occurrence of ESBL producing E. coli in husbandry
environment
ESBL producing E. coli were confirmed in husbandry environment
including domestic water, drinking water, feed and air. The prevalance
of ESBL producing E. coli in air of housholds 20% was slower than in
air of industrial farms 55% (P=0.03).

12


Table 3.5: The occurrence of ESBL producing E. coli in environmental
factors
Samples
Domestic water
Water in trough
Feed in trough
Air

Husbandry
method

The number of
tested samples

The number of
positive samples

Households
Farms
Households
Farms
Households
Farms
Households
Farms

60
20
60
20
60
20
60
20

3
1
27
6
15
6
12
11

%
5.0
5.0
45.0
30.0
25.0
30.0
20.0b
55.0a

Notice: The values in the same column with a,b different digits are different highly statistically
significant (P<0.05).

3.1.6 The occurrence of ESBL producing E. coli in chicken rearers
The chicken rearers were infected ESBL producing E. coli at high rate
62.5%. The prevalance of ESBL producing E. coli in chicken rearers
from households (60%) and farms (70%) was not significantly different
(P=0.424). These results showed ESBL producing E. coli not only
existed in chickens but also in human, specially human contacted
directly to chickens.
Table 3.6: The rate of chicken rearers was positive ESBL producing E. coli
Husbandry
method
Households
Farms
Total

The number of tested
samples (human)
60
20
80

The number of positive
samples (human)
36
14
50

%
60.0
70.0
62.5

3.2 The occurrence of ESBL producing E. coli at slaughterhouses
3.2.1 The results of ESBL producing E. coli isolation in chickens
The prevalence of ESBL producing E. coli in chicken carcasses at 12
slaughterhouses in Vinh Long, Tra Vinh, Soc Trang and Hau Giang
provinces was 42.22-53.33% (Table 3.7) and they were detected in
lung, liver, meat and feces (Table 3.8).

13


Table 3.7: The rate of chicken carcasses was positive ESBL producing E. coli

Location

The number of tested
samples (chicken)

Vinh Long
Tra Vinh
Soc Trang
Hau Giang
Total

45
45
45
45
180

The number of
positive samples
(chicken)

%
23
24
21
19
87

Table 3.8: The occurrence of ESBL producing E. coli in samples
The number of tested The number of positive
Samples
samples (chicken)
samples (chicken)
Liver
180
09
Meat
180
20
Lung
180
21
Feces

180

87

51.11
53.33
46.67
42.22
48.33

%
5.0
11.11
11.67
48.33

3.2.2 The results of ESBL producing E. coli isolation in
slaughterhouse environment
Table 3.9: The rate of environment samples was positive ESBL
producing E. coli
Sample

SMKS

SMDT

%

Air

12

0

0.00

Domestic water

12

0

0.00

Removing feather water

12

1

8.33b

Waste water

12

2

16.67b

Floor

12

7

58.33a

Notice: SMKS: the number of tested samples, SMDT: the number of positive samples. The values in the same

column with a,b different digits are different highly statistically significant (P<0.05).

ESBL producing E. coli were found in floor, removing feather water
and waste water. The occurrence of ESBL producing E. coli on floor
was high 58.33%. This can be a factor to transmit ESBL producing
E. coli from environment to chicken carcasses at slaughterhouses.

14


3.3 Antibiotic sensitivity of ESBL producing E. coli
3.3.1 Antibiotic sensitivity of ESBL producing E. coli isolated from
chickens and chicken rearers
Table 3.10: Antibiotic resistance of ESBL producing E. coli isolated from chickens
Antibiotics

Vinh Long
(n=502)
+

%

Tra Vinh
(n=548)
+

%

Soc Trang
(n=547)
+

Hau Giang
(n=263)
+

%

Total (n=1,860)
+

%

Am

493

98.21

544

99.27

540

98.72

262

99.62

1,839

98.87

Cu

431

85.86

516

94.16

515

94.15

248

94.30

1,710

91.94

Cr

450

89.64

493

89.96

528

96.53

253

96.20

1,724

92.69

Ge

237

47.21

350

63.87

457

83.55

175

66.54

1,219

65.54

Sm

376

74.90

454

82.85

283

51.74

246

93.54

1,359

73.06

Kn

246

49.00

351

64.05

367

68.34

183

69.58

1,118

60.11

Ak

12

2.39

11

2.01

52

9.51

6

2.28

81

4.35

Te

199

39.64

378

68.98

399

72.94

227

86.31

1.203

64.68

Dx

26

5.18

108

19.71

236

43.14

64

24.33

434

23.33

Nr

157

31.27

207

37.77

318

58.14

98

37.26

780

41.94

Of

139

27.69

191

34.85

268

48.99

79

30.04

677

36.40

Fos

36

7.17

16

2.92

48

8.78

6

2.28

106

5.70

Bt

425

84.66

498

91.04

377

68.92

211

80.23

1,511

81.24

Co

64

12.75

100

18.25

49

8.96

23

8.75

236

12.69

Notice: Am: ampicillin; Cu: cefuroxime; Cr: cefaclor; Ge: gentamicin; Ak: amikacin; Sm: streptomycin; Kn: kanamycin; Te:
tetracycline; Dx: doxycycline; Nr: norfloxacin; Of: ofloxacin; Fos: fosfomycin; Co: colistin; Bt: trimethoprim+sulfamethoxazo le.,
(+): the number of isolates resisted to antibiotics.

ESBL producing E. coli isolated from chickens were highly resistant to
ampicillin (98.87%), cefuroxime (91.94%), cefaclor (92.69%) and
trimethoprim/sulfamethoxazole (81.24%). However, they were highly
sensitive to amikacin (94.73%), fosfomycin (92.2%) and colistin
(86.13%). Especially, ESBL producing E. coli isolated from chickens in
Vinh Long were still highly sensitive to doxycycline (76,10%).
Similarly, the results in Table 3.12 and Table 3.13 showed ESBL
producing E. coli isolated from chicken rearers were also highly
resistant to ampicillin (96.67%), cefuroxime (100%), cefaclor (97.5%),
trimethoprim/ sulfamethoxazole and streptomycin same rate (75%) and
sensitive to amikacin (94.17%), fosfomycin (96.67%), colistin
(83.33%), doxycycline (70%), norfloxacin (66.67%), ofloxacin

15


(68.33%). Antibiotic types and resistance rate of ESBL producing
E. coli isolated from chickens and rearers were similar (Figure 3.1).
Table 3.11: Antibiotic sensitivity of ESBL producing E. coli isolated from chickens
Vinh Long
(n=502)

Antibiotics

+

%

Tra Vinh
(n=548)
+

Soc Trang
(n=547)

%

+

%

Hau Giang
(n=263)
+

%

Total (n=1,860)
+

%

Am

6

1.20

0

0.00

5

0.91

5

0.91

12

0.65

Cu

60

11.95

14

2.55

8

1.46

8

1.46

87

4.68

Cr

38

7.57

37

6.75

12

2.19

12

2.19

92

4.95

Ge

205

40.84

159

29.01

47

8.59

47

8.59

485

26.08

Sm

73

14.54

62

11.31

94

17.18

94

17.18

340

12.90

Kn

219

43.63

182

33.21

134

24.95

134

24.95

656

35.27

Ak

481

95.82

531

97.07

492

89.95

492

89.95

1,762

94.73

Te

123

24.50

66

12.04

58

10.60

58

10.60

265

14.25

Dx

382

76.10

234

42.70

222

40.59

222

40.59

954

51.29

Nr

298

59.36

315

57.48

182

33.27

182

33.27

918

49.35

Of

318

63.35

207

37.77

234

42.78

234

42.78

887

47.69

Fos

458

91.24

512

93.43

491

89.76

491

89.76

1,715

92.20

Bt

70

13.94

41

7.50

129

23.58

129

23.58

283

15.22

Co

436

86.85

446

81.39

497

90.86

497

90.86

1,602

86.13

Notice: (+):the number of isolates sensitized to antibiotics

Table 3.12: Antibiotic resistance of ESBL producing E. coli isolated from chicken rearers
Antibiotics

Vinh Long
(n=33)

Tra Vinh
(n=25)

Soc Trang
(n=38)

+

%

+

Am

29

87.88

25

%
100

+
38

%

Cu

33

100

25

100

Cr

33

100

25

100

Hau Giang
(n=24)
+

%

Total (n=120)
+

%

100

24

100

116

96.67

38

100

24

100

120

100

35

92.11

24

100

117

97.50

Ge

4

12.12

18

72.00

27

71.05

12

50.00

61

50.83

Sm

12

36.36

20

80.00

37

97.37

21

87.50

90

75.00

Kn

4

12.12

14

56.00

29

76.32

9

37.50

56

46.67

Ak

3

9.,09

3

12.00

0

0.00

1

4.17

7

5.83

Te

7

21.21

18

72.00

38

100

14

58.33

77

64.17

Dx

0

0.00

5

20.00

13

34.21

1

4.17

19

15.83

Nr

2

6.06

14

56.00

6

15.79

10

41.67

32

26.67

Of

3

9.09

14

56,00

8

21.05

5

20.83

30

25.00

Fos

1

3.03

0

0.00

0

0.00

0

0.00

1

0.83

Bt

17

51.52

25

100

31

81.58

17

70.83

90

75.00

Co

5

15.15

7

28.00

3

7.89

5

20.83

20

16.67

Notic: (+): the number of isolates resisted to antibiotics.

16


Table 3.13: Antibiotic sensitivity of ESBL producing E. coli isolated from chicken rearers
Vinh Long
(n=33)

Tra Vinh
(n=25)

Soc Trang
(n=38)

Hau Giang
(n=24)

Total (n=120)

Antibiotics

+

%

+

%

+

%

+

%

+

%

Am

1

3.03

0

0.00

0

0.00

0

0.00

1

0.83

Cu

0

0.00

0

0.00

0

0.00

0

0.00

0

0.00

Cr

0

0.00

0

0.00

2

5.26

0

0.00

2

1.67

Ge

27

81.82

5

20.00

10

26.32

11

45.83

53

44.17

Sm

14

42.42

4

16.00

0

0.00

0

0.00

18

15.00

Kn

27

81.82

9

36.00

9

23.68

14

58.33

59

49.17

Ak

30

90.91

22

88.00

38

100

23

95.83

113

94.17

Te

8

24.24

3

12.00

0

0.00

3

12.50

14

12.07

Dx

33

100

15

60.00

24

63.16

12

50.00

84

70.00

Nr

28

84.85

10

40.00

32

84.21

10

41.67

80

66.67

Of

30

90.91

10

40.00

30

78.95

12

50.00

82

68.33

Fos

30

90.91

25

100

38

100

23

95.83

116

96.67

Bt

16

48.48

0

0.00

5

13.16

3

12.50

24

20.00

Co

28

84.85

18

72.00

35

92.11

19

79.17

100

83.33

Notice: (+):the number of isolates sensitized to antibiotics
120
Tỉ lệ (%)



Người chăn nuôi

100

80

60

40

20

0
Am Cu

Cr

Ge

Sm Kn Ak Te Dx
Kháng sinh

Nr

Of Fos

Bt

Co

Figure 3.1: Resistance rate of ESBL producing E. coli isolated from chickens
and farmers

17


3.3.2 Antibiotic multiresistance of ESBL producing E. coli
Table 3.14: Antibiotic multiresistance of ESBL producing E. coli isolated from
chickens
Vinh Long
(n=502)

Tra Vinh
(n=548)

Soc Trang
(n=547)

Hau Giang
(n=263)

Total
(n=1,860)

+

+

%

+

%

0

0.00

11

0.59

0

0.00

24

1.29

0.91

5

1.90

67

3.60

18
43
27

3.29
7.86
4.94

13
26
25

4.94
9.89
9.51

92
181
206

4.95
9.73
11.08

15.51

64

11.70

19

7.22

247

13.28

18.61

110

20.11

55

20.91

342

18.39

79

14.42

114

20.84

71

27.00

308

16.56

8.37

57

10.40

120

21.94

37

14.07

256

13.76

6

1.20

29

5.29

36

6.58

7

2.66

78

4.19

12

1

0.20

31

5.66

8

1.46

4

1.52

44

2.37

13

0

0.00

1

0.18

1

0.18

1

0.38

3

0.16

14

0

0.00

0

0.00

1

0.18

0

0.00

1

0.05

The
number of
antibiotics

+

%

1

11

2.19

0

0.00

0

0.00

2

16

3.19

8

1.46

0

0.00

3

33

6.57

24

4.38

5

4
5
6

35
78
82

6.97
15.54
16.33

26
34
72

4.74
6.20
13.14

7

79

15.74

85

8

75

14.94

102

9

44

8.76

10

42

11

+

%

Table 3.15: Antibiotic multiresistance of ESBL producing E. coli isolated from
chicken rearers
The
number of
antibiotics
3

Vinh Long
(n=33)
+
%
19
57.58

Tra Vinh
(n=25)
+
%
0
0.00

Soc Trang
(n=38)
+
0
0.00

4

1

3.03

3

12.00

1

5

3

9.09

0

0.00

6

2

6.06

0

0.00

7

4

12.12

0

8

1

3.03

9

1

3.03

10

2

11

0

12
13

Hau Giang
(n=24)
+
%
3
12.50

2.63

0

0.00

2

5.26

3

4

10.53

4

0.00

4

10.53

12

48.00

11

3

12.00

11

6.06

3

12.00

0.00

1

4.00

0

0.00

2

0

0.00

1

Total
(n=120)
+
%
22
18.33
5

4.17

12.50

8

6.67

16.67

10

8.33

5

20.83

13

10.83

28.95

3

12.50

27

22.50

28.95

2

8.33

17

14.17

5

13.16

3

12.50

13

10.83

0

0.00

0

0.00

1

0.83

8.00

0

0.00

1

4.17

3

2.50

4.00

0

0.00

0

0.00

1

0.83

18


Đề kháng 3-4 loại kháng sinh

Đề kháng 1-4 loại kháng sinh

6,77%

Đề kháng 5-10 loại kháng sinh

4,17%

10,43%

Đề kháng 11-13 loại kháng sinh

Đề kháng 5-10 loại kháng sinh

22,50%

Đề kháng 11-14 loại kháng sinh

73,33%

82,80%

(a)

(b)

Figure 3.2: Distribution of antibiotic multiresistance in chickens (a) and
chicken rearers (b)

ESBL producing E. coli isolated from chickens were resistant to 1-14
antibiotics, multiresistant to 5-10 antibiotics 82.80% (Table 3.14,
Figure 3.2a), and they were found 359 multidrug resistance phylotypes.
ESBL producing E. coli isolated from chicken rearers were resistant to
3-13 antibiotics, multiresistant to 5-10 antibiotics 73.33% (Table 3.14,
Figure 3.2a) and they were confirmed 40 multidrug resistance
phylotypes.
3.4 The results of CTX-M, TEM and SHV determination
Table 3.16: Distribution of CTX-M, TEM, SHV genes in ESBL producing
E. coli isolated from all of the samples
Gen
TEM

E. coli sinh ESBL isolates (n=631)
Positive
%
544

86,21a

CTX-M

531

84,15a

SHV

345

54,68b

14

2,22c

No detect

Notice: The values in the same column with a,b different digits are different highly statistically
significant (P<0.05).

TEM, SHV and CTX-M genes were detected in ESBL producing
E. coli isolated from sample types in households, farms and
slaughterhouses. The results showed the prevalence of CTX-M
(84.15%) and TEM (86.21%) genes was higher than the prevalence of

19


SHV gene (54.68%). There were 7 occurrence types these genes in
ESBL producing E. coli isolated from chickens and 3 types in chicken
rearers. Combination of TEM, SHV and CTX-M genes in ESBL
producing E. coli was popular.
Table 3.17: Distribution of CTX-M, TEM, SHV genes in ESBL producing
E. coli isolated from chickens in households and farms
The number of positive samples (Percent %)
Gene
Vinh Long
(n=173)

Tra Vinh
(n=61)

Soc Trang
(n=122)

Hau Giang
(n=132)

Total
(n=488)

CTX-M

134 (77.46)

45 (73.77)

121 (99.18)

112 (84.85)

412 (84.43)

TEM

127 (73.41)

51 (83.61)

110 (90.16)

117 (88.64)

405 (82.99)

SHV

55 (31.79)

44 (72.13)

43 (35.25)

98 (74.24)

240 (49.18)

8 (4.62)

3 (4.92)

0

3 (2.27)

14 (2.87)

No detect

Table 3.18: Distribution of CTX-M, TEM, SHV genes in ESBL producing
E. coli isolated from chicken rearers
The number of positive samples (Percent %)
Gene
CTX
TEM
SHV

Vinh Long
(n=5)
5 (100)
5 (100)
4 (80.0)

Tra Vinh
(n=4)
2 (50.0)
4 (100)
4 (100)

Soc Trang
(n=6)
6 (100)
6 (100)
5 (83.3)

Hau Giang
(n=6)
6 (100)
6 (100)
5 (83.3)

Total
(n=21)
19 (90.5)
21 (100)
18 (85.7)

Table 3.19: Distribution of CTX-M, TEM, SHV genes in ESBL producing
E. coli isolated from egg shell and husbandry environment
The number of positive samples (Percent %)
Domestic
Water in
Feed in
Gene
Egg shell
water
trough
trough
Air (n=14)
(n=12)
(n=3)
(n=24)
(n=19)
CTX
12 (100)
3 (100)
16 (66.7)
14 (73.7)
10 (71.4)
TEM
12 (100)
3 (100)
21 (87.5)
16 (84.2)
14 (100)
SHV
7 (58.3)
2 (66.7)
18 (75.0)
14 (73.7)
7 (50.0)

20


Table 3.20: Distribution of CTX-M, TEM, SHV genes in ESBL producing
E. coli isolated from chicken and slaughterhouse environment
The number of positive samples (Percent %)
Removing
Gen
Chicken
Floor
Waste water
feather water
(n=40)
(n=7)
(n=2)
(n=1)
CTX-M
12 (100)
3 (100)
16 (66.7)
14 (73.7)
TEM
12 (100)
3 (100)
21 (87.5)
16 (84.2)
SHV
7 (58.3)
2 (66.7)
18 (75.0)
14 (73.7)
Table 3.21: Occurrence types of CTX-M, TEM and SHV genes in ESBL
producing E. coli isolated from chickens
The number of positive samples (Percent %)
Gene

CTX-M

Vinh Long
(n=173)

Tra Vinh
(n=61)

Soc Trang
(n=122)

Hau Giang
(n=132)

Total
(n=488)

31 (17.92)

6 (9.83)

1 (0.82)

4 (3.03)

42 (8.61)

TEM

13 (7.51)

2 (3.27)

0

7 (5.30)

22 (4.51)

SHV

4 (2.31)

0

6 (4.92)

4 (3.03)

14 (2.86)

CTX-M, SHV

3 (1.73)

1 (1.64)

1 (0.82)

4 (3.03)

9 (1.84)

CTX-M, TEM

65 (37.57)

7 (11.47)

73 (59.83)

20 (15.15)

165 (33.81)

TEM, SHV

12 (6.94)

12 (19.67)

1 (0.82)

6 (4.55)

31 (6.35)

CTX-M, TEM, SHV

37 (21.38)

30 (49.18)

40 (32.78)

84 (63.63)

191 (39.14)

Table 3.22: Occurrence types of CTX-M, TEM and SHV genes in ESBL
producing E. coli isolated from chicken rearers
The number of positive samples (Percent %)
Gene
CTX-M, TEM
TEM, SHV
TEM, CTX-M, SHV

Vinh Long
(n=5)

Tra Vinh
(n=4)

1 (20)

0

Soc Trang
(n=6)

Hau Giang
(n=6)

1 (16.7)

1 (16.7)

Total
(n=21)
3 (14.3)

0

2 (50)

0

0

2 (9.5)

4 (80)

2 (50)

5 (83.3)

5 (83.3)

16 (76.2)

21


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×