Tải bản đầy đủ

Tách dòng và giải trình tự Gene mã hóa Enzyme Nattokinase từ B. subtilis. (Khóa luận tốt nghiệp)

-----------

-----------

BACILLUS SUBTILIS

:

nh quy

Chuyên ngành

:

Khoa

: CNSH - CNTP
: 2011-2015

Thái Nguyên - 2015



-----------

-----------

MÃ HOÁ ENZYME
BACILLUS SUBTILIS

: Chính quy
Chuyên ngành

:
:

Khoa

s

: CNSH - CNTP
: 2011 - 2015
:

Thái Nguyên - 2015


i

cô,

, Th.S

,C

B
Thái Nguyên, B

N

Tôi


!
Thái Nguyên, ngày 18 tháng 6
Sinh viên

5


ii

Trang
......................................4
g nhân gene aprE ...............................................................13
.................................................16
..........................................................................20
.....................................................................23
HindIII và EcoRI .........................................26
BamHI và SacI.............................................26


iii

Trang
Hình 1:

.................................................................3

Hình 2:

.....................................8

Hình 3:

............................................................................15
aprE

Hình 4:

B. subtilis ......18

Hình 5:

...........................................................21

Hình 6:

B. subtilis.....................................28

Hình 7:

S

aprE

B. subtilis..................................................28

Hình 8:

................................................29

Hình 9:

...................30

Hình 10: K

........................31

Hình 11:

.............................................32

Hình 12:

........................................................33

Hình 13:

aprE ...................................................................................34

Hình 15:

................................................................37

Hình 16:

aprE ......................................................................38

Hình 17:

............................................................................39


iv

Amp

Ampicillin

Bp

Base pair

BLAST

Basic Local Aligenment Search Tool

DNA

Deoxyribonucleic axit

dNTP

Deoxynucleotide Triphotphate

E. coli

Escherichia coli

B. subtilis

Bacillus subtilis

Et al.
IPTG

Isopropyl Thiogalactoside

Kb

Kilo base kilo base nito

LB

Lauria Broth

SDS

Sodium Dodecyl Sulfate

PCR

Polymerase Chain Reaction - Ph n ng
chu i trùng h p

TAE

Tris- acetate- EDTA

EDTA

Etilenduamin tetraacetic acid

TE

Tris- EDTA

X -gal

5-bromo-4-chloro-3indoly- -D-galactoside


v

:

...............................................................................................................1
........................................................................................................................1
................................................................................................................2
...........................................................................................................2
..............................................................................2
.........................................................................................................2
..........................................................................................................2

:

......................................................................................3
..............................................................................3

2.2

Nattokinase.................................................................................4
......................................................................................................................4
.......................................................................................4

2.3.

Nattokinase..............................................................................................4
......................................................................................................................4

2.3.2. So

.......................................................................................5

2.4. T

...............................................................................................6
.................................................................................6

2.4.2.

,

h....................................................7
............................................................................7

2.4.4.

...........................................................................................................8

2.5

Nattokinase..........................................................................8

2.5.1.

.....................................................................................8

2.5.2.

............................................................................9

2.6

N

................................10

2.6.1.

...............................................................................................................10

2.6.2.

.................................................................................................11
:

.............................12
.......................................................................................................12
B. subtilis....................................................................................................12


vi
.....................................................................................................................12
.......................................................................................................................13
.........................................................................................................16
......................................................................................17
.....................................................................................................17
..............................................................................................18
aprE

3.4.1

B. subtilis .................18
..................................................19

........................................................................19
.......................................................................19
......................................................................................................20
.............................................................................21
...........................................22
3.4.8.

pTUAF ..................23
E.coli

.................24

.............................24
3.4.11.

.............26
....................26
aprE
i Ngân hàng Gen bank ..........................................................27
:

.............................................................................28
B. subtilis...............................................28
aprE

.............................28
agarose.....................29
..............................................................................30
..................................................................................................31
..............................31
..............................................................................32
.........................................32
.............................................................................................34
aprE

4.6.2

.......................34

aprE .................................................................................38


vii
:

.............................................................................40
.........................................................................................................................40
.......................................................................................................................40
THAM

O ...................................................................................................41
..............................................................................................................41
.............................................................................................................41


1

1.1.
,

(
.


. Nguyên

.

khác,

ó có

-

(Yanagisawa, Chatake et al. 2010)

men bán

B. subtilis

(Sumi, Hamada et al. 1987).
cao
B. subtilis

(Nguyen Sle,
Quyen et al. 2014)
,
mã hóa

B. subtilis,


2

aprE
B. subtilis (Nakamura, Yamagata et al. 1992)

E. coli

B. subtilis t

Nattokinase.

E. coli

Nattokinase
Nattokinase

Nattokinase

, giá thành khá cao.

công ty.
B. subtilis

tiên

aprE

-

E. coli

B. subtilis
aprE

hàng gene (Gene bank).

-

ý

trình phân tích
-

tách dòng gene.

-

Nattokinase sau này.

Nattokinase

.


3

(1600
1868).

,

chôn

.

ng
.
(Elahi,

Choi et al. 2015).
,

.
.

,

, natto

,

,

sung B. subtilis

,
cho vào
V

nyl
khô

(Sumi 1999).

Hình 1

. Trong

24

37ºC.
/g


4

Nattokinase

2.2
2.2.1.

(Kim, Gum et al. 2008)
Tên enzyme

Nattokinase
Cardiokinase
aprE

Gene mã hoá

B. subtilis
86029 [NCBI]

275 aa
28 kDalton
6,79

2.2.2.
Enzyme Nattokinase
Nattokinase

(Suzuki, Kondo et al. 2003), (Tai and Sweet 2006).
2.3.

Nattokinase

2.3.1.

Nattokinase

plasmin, Nattokinase

hình thành.

PAL -1
plasmin

.


5

máu

. Tuy nhiên,

.
,

.

t

,
,

. Và,

Th

,

, trong nh

các

enzym


.

,

và máu

t các enzym này

Tuy nhiên,
.Vì

,
Nattokinase

s

phò
, fibrinolysis

sinh lý chính

Nattokinase) là

trình sinh lý
phân

trong
,

rinolysis. Khi

Nattokinase

fibrin và

phân

Trong quá trình

máu, prourokinase

urokinase,

xúc tác

Nattokinase.

Nattokinase
ành



(Toki, Sumi et al. 1985).
2.3.2. So
2.3.2.1 Urokinase
Trong

Urokinase
x

,


6

.
i .Urokinase có chi phí

Nattokinase
100 gam Natto. Nattokinase duy trì

4-6

,

Urokinase.

2.3.2.2 Streptokinase
nh

trong

.

Urokinase

Streptokinase

2.3.2.3 Bromelain
Bromelain
trong quá trình fibrinolysis thông qua
kích thích

plasmin. Vì nattokinase

fibrin

-vitro nên nattokinase

nhân

plasmin

bromelain .
2.3.2.4
T
rinogen và fibrinopeptide

10% (Mansell and Reckless 1991).

2.3.2.5 Nhân sâm
Nhân sâm

.
.

Urokinase.
các so sánh trên,

Nattokinae

.
2.4. T
2.4.1.
1990,
Nattokinase

báo cáo
.


7

12
200 g N
plasmin
gian 2

.

,

v
plasmin

.
.

,

(euglobulin lysis time-ELT)
(Sumi, Hamada et al. 1990).
,
(Okamoto, Hanagata et al. 1995).
,
.

80%
4 trong 5

5

,

173,8 ± 20,5
10
2.4.2.

,

. Nattokinase

plasmin
.

2.4.3.
Nattokinase

lên men

khá lâu

E,
là có tác


8

2.4.4.
L



trên
2.5

Nattokinase

2.5.1.

R

ch

Ngâm

trong 40

- 121o C
60 phút

Lên men 12
45 -50o C

Hình 2:

Nattokinase


9

.
-

-

-

Ngâm:

-

ng 40-60 phút

:

115-1210C.

cafe

h

-

-

-500 C,trong vòng 12-24

Lên men:

Nattokinase.
2.5.2.

Nattokinase. Nattokinase
vi s
Nattokinase

.

E. coli

, E. coli


10

E. coli

E. coli
DNA và ch
galactosidase .
, E. coli
.
Nattokinase là aprE
Nattokinase
E. coli.
2.6. Tình

Nattokinase

2.6.1.

các
Pharmaceuticals
Nattokinase

Nattokinase, plasmin và elastase
. Elastase
Nhóm

này giú

Nattokinase
plasmin

Nattokinase v

elastase

(Chan, Fan et al. 2000)


11

- 450 gam Nattokinase. Tính trung bình
2
N

.
,

,

.
N

17

1986.
.

2.6.2.

Nattokinae

(Nguyen Sle, Quyen et al. 2014). P

Nattokinase

(

,
.
Nattokinase

(

.

Nattokinase vì

chung

. Vì
Nattokinase



12

B. subtilis
B. subtilis

Thái Nguyên.

B. subtilis

g LB

ml):
+ Bacto- tryptone : 10g
+Bacto Yeast extract : 5g
+ NaCl : 10g

+ Buffer
+ MgCl2 20mM
+ Taq- DNA Polymerase
+ dNTPs

+ Agarose 1 %
+
100%).
+ Loading dye 6X
+ Ethidium bromide

Tris base, EDTA, NaOH, Acid acetic


13

+ 10X Ligation Buffer
+ T4 DNA Ligase

+ Vector pTUAF

-Agar- Amp- Xgal- IPTG
+ Kháng sinh Ampicilin 100mg/ml
+ X- gal stock solution (20mg/ml)
Cân 0,2g X-gal (5- bromo -4-Chloro -3 indolyl- - D- galactopyramoside) vào
- 20oC.

10ml N- N+ IPTG 100mM
Cân 1,2 g IPTG (isopropyl- - Do

C.

SacI, HindIII, BamHI, Eco

3.1.3.1
aprE

2
Tên

aprE
-

Enzyme
aprE

aprE - F

TGAGCTCTTATTGTGCAGCTGCTTG

SacI
825bp

aprE- R

CGCTGGATCCGCGCAATCTGTTCT

BamHI


14

-

BamHI GGATCC

và SacI GAGCTC

aprE
aprE

B. subtilis
TTA trên gene aprE SacI
aprE

B. subtilis.

3.1.3.2 Vector tách dòng pTUAF

Taq- DNA

enzyme Taq- DNA

LacZ mã hóa cho enzyme
Lac-

ne LacZ

galactosidase và


15

-

gal thành

ch
gal nên các khu
.
EcoRI, Ecl136II, SacI, Acc65I, KpnI, Bsp68I,
Mva1269I, Mph1103I, Xbal, BamHI, Cfr9I, Eco88I, SmaI, ApaI, Bsp120I, HincII, SalI,
XmiI, PstI, AlfI, Eco147I, PaeI, Hin
SacI, Bam

Hin

này

Hình 3:


16

Tên
Thái Nguyên (Thai Nguyen University of Agriculture and Forestry).
p,

T
T-

g 3:

Máy PCR

Amplied Biosystems USA/ Singapore
Scie- plas Ltd- UK
Gel logic 1500 Kodak- USA
SK3000

Jeotech Korea

Canada Bio Water system- Pall Co- UK
Nu- 425- 400E- Nuaire - USA
HV- 110- Hirayama- Japan
Máy Vortex

Vortex Genius 3

IKA Genmany/ China

Máy Spindown

E- centrifuge- Wealtec

Taiwan/ USA

F- 51BW- Horiba- Japan
Lò vi song
-200C, -800C

MS- 2347AR- LG VN
Super freezer Ecol130- Ficchetti- Italia
TE 214S- Startorius Germany
Techne- OSI

Pipette

Thermo Labsystem- Finland
Jeiotech

Máy li tâm

Korea

Eppendorf
Pal- Co- UK


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×