Tải bản đầy đủ

Bước đầu nghiên cứu phương pháp phát hiện nhanh trực trùng mủ xanh (Pseudomonas aeruginosa) kháng thuốc kháng sinh nhóm βlactam bằng kỹ thuật PCR. (Khóa luận tốt nghiệp)

:

Peudomonas aeruginosa
-

:

CHÍNH QUY

Chuyên ngành

:

Khoa

:

CNSH - CNTP

:


K43 - CNSH

:

2011 - 2015

THÁI NGUYÊN 2015


Tôi xin chân thành c

:

Các

Tôi xin chân thành

:

TS. Ngu

cho tôi

vi


Thái Nguyên, ngày 28 tháng 5
Sinh viên


:C

................................ 18

:

............................... 18

:


................... 19
Pseudomonas aeruginosa kháng thu

:

Thái Nguyên .... 30
:

Pseudomonas aeruginosa
............................................... 33
Pseudomonas

:

aeruginosa ..................................................................................................... 38
:
hình kháng -

gene kháng metallo -lactamase
Pseudomonas aeruginosa

......................................................................................................................... 41


Pseudomonas aeruginosa kháng

Hình 4.1: K
B

k

Thái Nguyên. ... 31

Hình 4.2:
Pseudomonas aeruginosa............................................................ 36
Hình 4.3:

-

OPRLR ............................................................................................................ 38
Hình 4.4:
blaIMPF-blaIMPR và blaVIMF-blaVIMR .............................. 40


T , thu t ng vi t t t
CIAA
DNA
dNTPs
OD

c a t , thu t ng
H n h p g m 24 chloroform : 1 isoamylalcohol
(v/v)
Deoxyribonucleic Acid
Deoxyribonucleotide triphosphates (H n h p g m
dATP, dGTP, dCTP, dTTP)
Optical Density - M

quang

Polymerase Chain Reaction
PCR

chu i trùng h p

Ph n ng t ng h p

ch quá trình t ng khu

i

c hi u in vitro
RNA
ELISA

Ribonucleic Acid
Enzyme Linked Immunosorbent Assay
h p th mi n d ch liên k t v i enzyme

K thu t


:

............................................................................................ 1
................................................................................................... 1

1.2.

................................................................... 3

1.3.

....................................................................................... 3
:

................................................................. 5
Pseudomonas aeruginosa)................. 5
Pseudomonas aeruginosa)..... 5
................................................................................... 6
................................................ 8

2.2.2.

Pseudomonas aeruginosa

....... 8

Pseudomonas aeruginosa

......... 9

.......................................... 11
............................. 11
.......................................... 11
................. 12
Pseudomonas aeruginosa ........... 13
Pseudomonas aeruginosa

...... 14
................ 14

2.4.2.

................. 15

2.4.3.

........................................................................................ 15
:

. 17
............................................................ 17
............................................................................ 17
............................................................................... 17
............................................................... 17
............................................................................. 17


............................................................................ 17
.................................................................................. 17
.......................................................... 17
.............................................................. 18
.................................................................................... 19
................................................................................ 19
.......................................................................... 19
Pseudomonas aeruginosa

.......... 19

................................................... 24
Pseudomonas aeruginosa kháng
................................................................................. 25
:

........................................................ 29
Pseudomonas

aeruginosa
Thái Nguyên.................................................................................................... 29
Pseudomonas aeruginosa
.................................. 32
Pseudomonas aeruginosa kháng
................................................................................................................ 35
........................................................................ 35
Pseudomonas aeruginosa .................................. 37
Pseudomonas

4.3.3.
aeruginosa
:

.................................................................................. 39
........................................................ 44
.................................................................................................... 44
.................................................................................................. 45


1.1.
Pseudomonas aeruginosa)

P. aeruginosa)

do

ng cao. Theo
báo cáo

P. aeruginosa.
P. aeruginosa
(Fatima A. và cs,
2012) [22]. Theo

,

P.

aeruginosa
2012
Piperacillin (36,8%) và Ciprofloxaxin (33,3%) (Joseph N. M. và cs, 2013)
[26].

2007

P. aeruginosa
2008) [8].


P.
aeruginosa
one (58,5%) và Gentamicin (54%)
[6].
P. aeruginosa

P. aeruginosa

P. aeruginosa

hóa sinh và làm k
P. aeruginosa

-

e

tính

PCR,

cho phép


P-

-


Pseudomonas
aeruginosa)

-lactam

Trong khuôn
Pseudomonas aeruginosa
2

lactam.
1.2.
-

xanh (Pseudomonas aeruginosa) kháng
Pseudomonas aeruginosa

+

Thái Nguyên.
+

Pseudomonas aeruginosa

+
Pseudomonas aeruginosa
1.3.
-

Pseudomonas aeruginosa

.

+
Pseudomonas aeruginosa


+
Pseudomonas aeruginosa


2.1.

Pseudomonas aeruginosa)

P. aeruginosa
là Bacterium aeruginosa (Lê Huy Chính và cs, 2001) [3].

Pseudomonas

Pseudomonas aeruginosa (Lê

Huy Chính và cs, 2001) [3].
P. aeruginosa
P. aeruginosa

-

1999) [4].

P. aeruginosa
[5].
P. aeruginosa

[7].

P. aeruginosa

và cs, 2006) [13].


2.1.2
- Hình
Gram âm, hình que,
0.5 -

.D

h bào

(Balcht và

cs, 1994) [18].
-

Pseudomonas aeruginosa

P. aeruginosa

P.
aeruginosa
M. và cs, 1982) [33].
+ Tiên mao:
Pseudomonas aeruginosa

+ Tiêm mao:

(Mutharia L.


+ Nhân:
P. aeruginosa
P. aeruginosa

e

-lactamase làm phá
P. aeruginosa

-

P. aeruginosa gây ra.
trùng

(P. aeruginosa)

(
37o

- 42o
- 9,0 (

- 7,5
[1].
,

.


seudomonas
Lateef A.
P. aeruginosa

P. aeruginosa

sinh (ampicillin, chloramphenicol, cloxacillin, erythromycin, penicillin,

nhau (augmentin, amoxycillin, tetracycline, cotrimoxazole, nalidixic acid,
P. aeruginosa
kh
tetracycline, cloxacillin, cotrimoxazole) (Lateef A. và cs, 2005) [28].

P. aeruginosa khá cao. Gales A. C. (1997-1999),
6631

P. aeruginosa

P. aeruginosa

(Gales A. C. và cs, 2001) [23].
Oguntibeju O. O. và Nwobu R. A. U.

P. aeruginosa
P. aeruginosa

P. aeruginosa


n
streptomycin (30%), và tetracycline (10%) (Oguntibeju O. O. và cs, 2004)
[34
P. aeruginosa

fosfomycin có
(Mirakhur A. và cs,

2003) [31].
P. aeruginosa

Theo Hirulkar N. B. và Soni B.

P. aeruginosa khi

.T

Gentamicin
(51%), Nitrofurantoin (51%), Erythromycin (50%), Cotrimoxazole (50%),
Ofloxacin (50%), tetracycline (46%), tfloxacin (46%), Cefalexin (46%),
Metronidazole (46%), Ampicillin (41%), Penicillin (41%) và Amoxycillin
(41%) (Hirulkar N. B. và cs, 2011) [25].
P.

Joseph N. M.
aeruginosa

.

Gentamicine (59,6%), Piperacillin (36,8%) và Ciprofloxaxin (33,3%) (Joseph N.
M. và cs, 2013) [26].
2.2.2. Tình hình

Pseudomonas aeruginosa
P. aeruginosa

t
t
P. aeruginosa
trùng


kháng ofloxacin là 58,3%, kháng norfloxacin 55,2% và kháng ciprofloxacin
43,8%

[11].

Nghiên

B

a khoa

P. aeruginosa

2003-

P. aeruginosa và Pseudomonas sp
P. aeruginosa
âm (28,6%)

và cs, 2004) [12].
(2005), tác nhân gây

P. aeruginosa
a ICU: khoa
imipenem (66,7%), ticarcillin/a.clavulanic (45%), ceftazidime
(74,1%), cefepime (77,8%), ciprofloxacin (96,3%) (

P. aeruginosa
Chí Minh. P. aeruginosa có m

[9].

Pasteur,
áng sinh: CS(10,7%), FOS

(24%), ATM(36%), AN (42,9%), CIP(48,2%), FEP (45,8%), IPM (46,2%), GM
(55,6%), CFP(54,2%), TCC (54,2%), TM(54,2%), PIP(60,7%), CFS (62,5%),
P. aeruginosa và


P. aeruginosa là khá cao (trên 40%) (
cs, 2014) [2].
2.3

penicillinase

(Guardabassi L. và cs, 2006) [24].

t các enzyme

-

-lactamase

(Anton Y. P. và cs, 2010) [17];
(Bush K. và cs, 2010) [19].

carbapenemases có

P.
aeruginosa

(Mulvey M. R. và cs, 2009) [32].

là penicillin binding protein (PBP) (Mulvey M. R. và cs, 2009) [32].


các kháng sinh nhóm betac
inh này (Anton Y. P. và cs, 2010) [17].

màng (porins). Protein ngoài màng này ch

bao

P. aeruginosa
-lactam
(Livermore D. M. và cs, 2001) [29].

minocycline, doxycyc-

Tet (Tet-

MefA/E
nhóm macrolides), AmrAB-OprA, MexXY-OprM và AcrD
aminoglycosides), MexAB-OprM (
TolC và Mex
[30].

-lactam), AcrAB(McGowan JE Jr., 1983)


Theo Daniel J. W.

áng

sinh nhóm -

(Daniel J. W. và cs, 2013)

[21]:
P. aeruginosa
P. aeruginosa
-lactam.

2, và SHV-1.

plasmid mã hóa TEM-1, TEM-lactamases

-

-lactamase.
cephalosporin, oxyimino-cephalosporin

(ceftazidime và cefotaxime) và các monobactam aztreonam.
P. aeruginosa

Nhóm Penicillin

-1,

PSE-3, PSE-4, PSE-5, CARB-3, và CARB-

P. aeruginosa

-clavulanate

Nhóm OXA-type Penicillinases:

Nhóm OXA-

P.

oxyiminoaeruginosa.

Nhóm OXA-type Carbapenemases: các OXA-type carbapenemases có ái
chúng
chúng.


Nhóm Carbapenemases:

llin, cephalosporin

và aztreonam
-lactamase

2.3.4.2.
P. aeruginosa
amino acid

P. aeruginosa

(Daniel J. W. và

cs, 2013) [21].
P. aeruginosa.

-

P.

aeruginosa

-

MexAB-OprM, MexCD-OprJ và MexXY (Daniel J. W. và cs, 2013)
[21].
Pseudomonas aeruginosa

- Nguyên lý: Kháng sinh trong
P. aeruginosa
P. aeruginosa

sinh (CLSI, 2010) [20].
.
-


2.4.2.

a kháng sinh (MIC)

-

-

(CLSI, 2010)
[20].
-

2.4.3.
-

-

-

e

e kháng kháng sinh (Kumarasamy K. K. và cs, 2010) [27].
-



Pseudomonas aeruginosa
tháng
12

.

Pseudomonas aeruginosa
tháng 12
.

-

B

-

-

T

-

2/2014

.

05/2015

OPRLFPseudomonas aeruginosa,
blaIMPF-

g
-

-lactam
-


(Aghamiri S. và cs, 2014) [16].
công

(www.IDTDNA.com).

Tm (oC)
PCR (bp)
OPRLF
OPRLR
blaIMPF
blaIMPR
blaVIMF
blaVIMR

STT
1
2
3
4
5
6
7
8
9
10
11
12
13

ATGGAAATGCTGAAATTCGG
CTTCTTCAGCTCGACGCGAC
GTTTGAAGAAGTTAACGGGTGG
ATAATTTGGCGGACTTTGGC
TGGTGTTTGGTCGCATATCG
GAGCAAGTCTAGACCGCCCG

CTAB
Chloroform
Isoamyl ahcohol
Isopropanol
CH3COONa 3M (pH= 5,5)
Ethanol
Agarose
Ethidium bromide
PCR buffer
dNTPs (dATP, dGTP, dCTP, dTTP)
Taq DNA polymerase
Primer

60
66
63
62
64
68

483
459
595


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×