Tải bản đầy đủ

BCTT ĐỀ TÀI: NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULIC

BỘ GIÁO DỤC VÀ ĐÀO TẠO
ĐẠI HỌC THÁI NGUYÊN

BÁO CÁO TÓM TẮT
ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ
Tên đề tài:

NGHIÊN CỨU TẠO CHỦNG
ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN
XUẤT VANILLIN TỪ AXIT FERULIC
Mã số: B2013-TN03-01
Chủ nhiệm đề tài: TS. Dƣơng Văn Cƣờng

Thái Nguyên, tháng 10 năm 2016


BỘ GIÁO DỤC VÀ ĐÀO TẠO
ĐẠI HỌC THÁI NGUYÊN

BÁO CÁO TÓM TẮT
ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ


Tên đề tài:

NGHIÊN CỨU TẠO CHỦNG
ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN
XUẤT VANILLIN TỪ AXIT FERULIC
Mã số: B2013-TN03-01

Xác nhận của tổ chức chủ trì

Chủ nhiệm đề tài

TS. Dƣơng Văn Cƣờng

Thái Nguyên, tháng 10 năm 2016


ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ
NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT
VANILLIN TỪ AXIT FERULIC
Mã số: B2013-TN03-01
Chủ nhiệm: TS. Dương Văn Cường
DANH SÁCH NHỮNG NGƢỜI THAM GIA THỰC HIỆN ĐỀ TÀI
STT

Họ và tên

1

TS. Dương Văn Cường

2

ThS. Bùi Tuấn Hà

3

TS. Nguyễn Văn Duy

4


ThS. Lương Thị Thu
Hường

5

Ths. Nguyễn Thị Tình

6

Nội dung nghiên cứu đƣợc
giao

Đơn vị công tác

Khoa Công nghệ sinh
học và Công nghệ thực
phẩm, Trường Đại học
Nông Lâm Thái
Nguyên.

KS. Ma Thị Trang

-

Chủ nhiệm đề tài

-

Thiết kế các vector biểu hiện

-

Thử nghiệm quy trình lên
men

-

Tách dòng và xác định trình
tự 3 gene gltA, fcs và ech

-

Phân tích định tính và định
lượng sản phẩm vanillin tạo
thành bằng HPLC

-

Xác định điều kiện nuôi cấy
tối ưu

-

Cảm ứng biểu hiện các gene
đích.

-

So sánh các hệ vector/vật
chủ để tìm ra hệ thống cho
sản lượng cao nhất.

-

Biến nạp các vector biểu
hiện chứa các gene đích vào
tế bào chủ.

Viện Khoa học sự sống,
Đại học Thái Nguyên
7

KS. Vũ Hoài Nam


MỤC LỤC
DANH MỤC CÁC BẢNG ................................................................................................... vi
DANH MỤC CÁC TỪ, CỤM TỪ VIẾT TẮT ..................................................................viii
THÔNG TIN KẾT QUẢ NGHIÊN CỨU ............................................................................ ix
INFORMATION ON RESEARCH RESULTS ..................................................................xii
PHẦN 1: MỞ ĐẦU .............................................................................................................. 1
PHẦN 2: TỔNG QUAN TÀI LIỆU ................................................................................... 2
PHẦN 3: MỤC TIÊU, ĐỐI TƢỢNG, PHẠM VI, CÁCH TIẾP CẬN, NỘI DUNG VÀ
PHƢƠNG PHÁP NGHIÊN CỨU....................................................................................... 3
3.1. Mục tiêu nghiên cứu .................................................................................................... 3
3.2. Đối tượng và vật liệu nghiên cứu ................................................................................ 3
3.2.1. Các chủng vi sinh vật ........................................................................................... 3
3.2.2 Các vector tách dòng và biểu hiện ......................................................................... 3
3.2.3. Mồi khuếch đại các gen gltA, fcs và ech .............................................................. 3
3.2.4. Hóa chất, thiết bị................................................................................................... 4
3.3. Phạm vi nghiên cứu ..................................................................................................... 4
3.4. Cách tiếp cận ............................................................................................................... 4
3.5. Nội dung nghiên cứu ................................................................................................... 4
3.6. Phương pháp nghiên cứu ............................................................................................. 5
PHẦN 4: KẾT QUẢ VÀ THẢO LUẬN............................................................................. 6
4.1. Tách dòng và giải trình tự các gene mã hóa các enzyme xúc tác con đường sinh tổng
hợp vanillin từ axit ferulic.................................................................................................... 6
4.1.1. Tách dòng gene gltA từ E. coli DH5α .................................................................. 6
4.1.2. Tách dòng gene ech từ P. fluorescens VTCC-B-668 ........................................... 6
4.1.3. Tách dòng gene fcs từ Amycolatopsis sp. HR104................................................ 6
4.2 và 4.3. Thiết kế hai vector biểu hiện chứa 3 gen gltA, ech, fcs ................................... 6
4.4. Sinh tổng hợp vanillin từ axit fefulic sử dụng E. coli tái tổ hợp làm tế bào chủ ........ 7
4.4.1. Ảnh hưởng của nồng độ axit ferulic đến sinh trưởng E. coli ............................... 7
4.4.2. Xác định axit ferulic tồn dư và vanillin được tổng hợp bởi hệ thống pET22....... 7
4.5. Ảnh hưởng của các điều kiện nuôi cấy lên năng suất sinh tổng hợp vanillin ............. 8
4.5.1. Ảnh hưởng của thời gian nuôi cấy........................................................................ 8
4.5.2. So sánh các môi trường LB, M9 và 2YT ............................................................. 9
4.5.3. Ảnh hưởng của nồng độ chất cảm ứng IPTG ....................................................... 9
4.6. So sánh hiệu suất sinh tổng hợp vanillin giữa hai hệ vector pET22 và pRSET........ 10
4.7. Lên men E. coli sinh tổng hợp vanillin và thu hồi sản phẩm .................................... 11


4.7.1. So sánh hai quy trình lên men ............................................................................ 11
4.7.2. Thu hồi sản phẩm vanillin .................................................................................. 11
4.8. So sánh hiệu suất sinh tổng hợp vanillin của hệ thống pET22-GEF với các nghiên
cứu tương đồng trên thế giới ............................................................................................ 12
PHẦN 5: KẾT LUẬN VÀ KIẾN NGHỊ ......................................................................... 14
5.1. Kết luận ..................................................................................................................... 14
5.2. Kiến nghị ................................................................................................................... 14
TÀI LIỆU THAM KHẢO ................................................................................................. 15


DANH MỤC CÁC BẢNG
Bảng 3.1: Trình tự mồi khuếch đại gen ................................................................................. 3
Bảng 4.1. So sánh hiệu suất sinh tổng hợp vanillin của nghiên cứu này với các nghiên cứu
tương đồng trên thế giới....................................................................................................... 13


DANH MỤC HÌNH
Hình 2.1: Con đường sinh tổng hợp vanillin từ acid ferulic .................................................. 2
Hình 4.1. Cấu trúc hai vector tái tổ hợp ................................................................................. 6
Hình 4.2: Ảnh hưởng của nồng độ axit ferulic ban đầu với sinh trưởng của E. coli tái tổ
hợp mang vector pET22-GEF ................................................................................................ 7
Hình 4.3: Phân tích HPLC động học sự chuyển hóa axit ferulic thành vanillin ở chủng E.
coli BL21(DE3) tái tổ hợp mang vector pET22-GEF. .......................................................... 7
Hình 4.4: Ảnh hưởng của thời gian nuôi cấy tới khả năng sinh trưởng và sinh tổng hợp
vanillin của chủng E. coli tái tổ hợp. ..................................................................................... 8
Hình 4.5: So sánh khả năng sinh trưởng và sinh tổng hợp vanillin của E. coli tái tổ hợp trên
các môi trường LB, M9 và 2YT. ........................................................................................... 9
Hình 4.6: Ảnh hưởng của nồng độ IPTG đến sinh tổng hợp vanillin. ................................. 10
Hình 4.7. So sánh hiệu suất sinh tổng hợp vanillin từ cơ chất axit ferulic sử dụng các chủng
E. coli tái tổ hợp mang vector pET22-GEF và pRSET-GEF ............................................... 10
Hình 4.8. So sánh hiệu suất sinh tổng hợp vanillin giữa hai phương pháp lên men ............ 11
Hình 4.9. Tinh thể vanillin thu nhận được sau khi chiết xuất .............................................. 11


DANH MỤC CÁC TỪ, CỤM TỪ VIẾT TẮT
4-CL
ATP
Bp
CCl4
CoA
ĐHQGH
DNA
DNA-PK
DNA-PK
dNTP
E. coli
EDTA
HCLC
IPTG
Kb
LB
NCBI
PCR
SDS
TAE
TCA
VAO
X-gal

: 4-hydroxycinnamate-CoA ligase
: Adenosine triphosphate
: Base pair
: Carbon tetrachloride
: Coenzyme Acetoacetyl
: Đại học quốc gia Hà Nội
: Deoxyribonucleic acid
: DNA protein kinase
: DNA protein kinase
: Deoxyribonucleotide triphosphate
: Escherichia coli
: Etilenduamin tetraacetic acid
: 4-hydroxycinnamate CoA-hydratase/lyase
: Isopropy Thyogalactoside
: Kilo base
: Lauria Broth
: NationCenter for Biotechnology Information
: Polymerase Chain Reaction
: Sodium doecyl sulfat
: Tris acetate EDTA
: Tricarboxylic acid
: Vanillyl alcohol oxidase
: 5-bromo-4chloro-3indoly-β-D-galactoside


Mẫu 21. Thông tin kết quả nghiên cứu đề tài khoa học và công nghệ cấp bộ
BỘ GIÁO DỤC VÀ ĐÀO TẠO
ĐẠI HỌC THÁI NGUYÊN
THÔNG TIN KẾT QUẢ NGHIÊN CỨU
1. Thông tin chung:
- Tên đề tài: Nghiên cứu tạo chủng Escherichia coli có khả năng sản xuất vanillin
từ axit ferulic
- Mã số: B2013-TN03-01
- Chủ nhiệm đề tài: TS. Dương Văn Cường
- Tổ chức chủ trì: Đại học Thái Nguyên
- Thời gian thực hiện: Từ 01/2013 đến 06/2016
2. Mục tiêu:
Sử dụng các công cụ kỹ thuật di truyển để cải biến E. coli tự nhiên BL21(DE3) tạo
ra chủng tái tổ hợp có khả năng sinh tổng hợp vanillin từ cơ chất axit ferulic.
3. Tính mới và sáng tạo:
Đề tài là nghiên cứu đầu tiên trong nước tạo ra được chủng vi khuẩn E. coli tái tổ
hợp mang ba gen mã hóa cho ba enzyme xúc tác con đường sinh tổng hợp axit ferulic
thành vanillin.
4. Kết quả nghiên cứu:
- Đã tách dòng và giải trình tự thành công ba gen mã hóa con đường sinh tổng hợp
vanillin từ axit ferulic, bao gồm:
o Gen gltA mã hóa enzyme citrate synthase từ E. coli DH5α chịu trách nhiệm
chuyển hoá acetyl-CoA thành CoA
o Gen fcs mã hóa enzyme feruloyl-CoA synthase từ Amycolatopsis sp. HR104
(DSM 9991) chịu trách nhiệm chuyển hóa axit ferulic thành feruloyl-CoA
o Gen ech mã hóa enzyme enoyl-CoA hydratase/aldolase từ P. fluorescens VTCCB-668 chịu trách nhiệm chuyển hóa feruloyl-CoA thành vanillin
- Đã thiết kế thành công hai vector biểu hiện mang operon đa cistron
(multicistronic operon) chứa 3 gene gltA-ech-fcs:
o Vector pRSET-GEF
o Vector pET22-GEF
- Đã biến nạp các vector biểu hiện vào E. coli BL21(DE3) và cảm ứng biểu hiện
các gen đích mã hóa các enzyme chuyển hóa được axit ferulic thành vanillin.


- Đã phân tích được hiệu suất sinh tổng hợp vanillin của E. coli tái tổ hợp bằng
phương pháp HPLC. Hệ thống pET22-GEF và pRSET-GEF đạt hiệu suất lần lượt là 1.44
g/L và 1.17 g/L.
- Đã xác định được các điều kiện thích hợp cho sinh tổng hợp vanillin:
o Nồng độ axit ferulic: 3 g/L
o Thời gian nuôi cấy: 36 h
o Môi trường nuôi cấy: LB
o Nồng độ chất cảm ứng IPTG: 0.5 mM
- Đã thiết lập được quy trình lên men E. coli sinh tổng hợp vanillin từ axit ferulic
có hiệu suất đạt 1.42 ± 0.13 (sử dụng bình tam giác) và 1.53 ± 0.06 (sử dụng hệ thống
Labfors)
- Đã thu hồi được 100 gram vanillin từ dịch lên men E. coli.
5. Sản phẩm:
5.1. Sản phẩm đào tạo:
Đào tạo sau đại học: 01 luận văn thạc sỹ ngành Sinh học thực nghiệm
- Học viên Ma Thị Trang. Tên luận văn: “Nghiên cứu tạo chủng Escherichia coli
có khả năng sản xuất vanillin từ axit ferulic”.
Đào tạo đại học: 03 khóa luận tốt nghiệp đại học ngành Công nghệ Sinh học
- Sinh viên Lê Thị Quỳnh Hoa. Tên khóa luận: “Thiết kế vector biểu hiện các gen
mã hóa enzyme sinh tổng hợp vanillin trong E. coli”.
- Sinh viên Nguyễn Thị Thu Hường. Tên khóa luận: “Tách dòng và xác định trình
tự gene gltA mã hóa cho enzyme citrate synthase từ vi khuẩn E. coli”.
- Sinh viên Hoàng Thị Thúy Quỳnh. Tên khóa luận: “Tách dòng và giải trình tự
gene mã hóa enzyme feruloyl-coa synthase từ chủng Amycolatopsis sp. HR104”.
5.2. Sản phẩm khoa học: 02 bài báo khoa học
- Ma Thị Trang, Lương Thị Thu Hường, Lê Thị Quỳnh Hoa, Dương Văn Cường
(2015), “Tách dòng, giải trình tự và thiết kế vector biểu hiện các gien mã hóa các enzym
tổng hợp vanillin từ axit ferulic”, Tạp chí Nông nghiệp và Phát triển nông thôn, tập 11, Tr.
274-283.
- Dương Văn Cường, Lê Thị Quỳnh Hoa (2016), “Sinh tổng hợp vanillin từ axit
ferulic sử dụng E. coli tái tổ hợp”, Tạp chí Nông nghiệp và Phát triển nông thôn, tập 94,
Tr. 68-75.


5.3. Sản phẩm ứng dụng:
- 01 quy trình tạo chủng vi khuẩn E. coli tái tổ hợp mang vector biểu hiện chứa
các gene gltA, fcs và ech
- 02 chủng E. coli BL21(DE3) tái tổ hợp có khả năng sinh tổng hợp vanillin từ
axit ferulic mang các vector pRSET-GEF và pET22-GEF
- 01 quy trình lên men E. coli sinh tổng hợp vanillin từ axit ferulic
- 100 gram vanillin
6. Phƣơng thức chuyển giao, địa chỉ ứng dụng, tác động và lợi ích mang lại của kết
quả nghiên cứu:
Đề tài tạo ra một phương pháp sản xuất vanillin chủ động từ cơ chất axit ferulic
bằng vi khuẩn E. coli tái tổ hợp. Sản phẩm của đề tài có thể áp dụng ở những đơn vị có
những trang thiết bị cơ bản gồm tủ lạnh âm sâu (để duy trì chủng giống), hệ thống lên men
và một số thiết bị, hóa chất để chiết xuất vanillin.
Ngày 27 tháng 10 năm 2016
Tổ chức chủ trì
(ký, họ và tên, đóng dấu)

Chủ nhiệm đề tài
(ký, họ và tên)


Mẫu 22. Thông tin kết quả nghiên cứu đề tài khoa học và công nghệ cấp bộ bằng tiếng
Anh
MINISTRY OF EDUCATION AND TRAINING
THAI NGUYEN UNIVERSITY
INFORMATION ON RESEARCH RESULTS
1. General information:
- Project title: Construction of recombinant E. coli strain for biosynthesis of
vanillin from ferulic acid
- Code number: B2013-TN03-01
- Coordinator: Duong Van Cuong, PhD
- Implementing institution: Thai Nguyen University
- Duration: From Jan 2013 to June 2016
2. Objective(s):
Metabolic engineering of a recombinant E. coli strain which is capable of
biosynthesis of vanillin from ferulic acid substrate.
3. Creativeness and innovativeness:
In Vietnam, this is the first study aimed to and succeeded in introducing three genes
encoding for vanillin biosynthesis pathway into E. coli BL21(DE3). The recombinant
strain could be used as a cell factory to convert ferulic acid to vanillin.
4. Research results:
- Three genes encoding for three enzymes, which are responsible for the
biosynthesis pathway from ferulic acid to vanillin, were cloned and sequenced, including:
o gltA gene was cloned from E. coli DH5α. This gene encodes citrate synthase
enzyme that catalyze the reaction converting acetyl-CoA to CoA.
o fcs gene was cloned from Amycolatopsis sp. HR104 (DSM 9991). This gene
encodes feruloyl-CoA synthase enzyme that catalyze the reaction converting ferulic acid to
feruloyl-CoA.
o ech gene was cloned from P. fluorescens VTCC-B-668. This gene encodes
enoyl-CoA hydratase/aldolase enzyme that catalyze the reaction converting feruloyl-CoA
to vanillin.
- Constructed two expression vectors harboring the multicistronic operon of the
above mentioned three genes gltA-ech-fcs:
o pRSET-GEF vector


o pET22-GEF vector
- Recombinant vectors were transformed into E. coli BL21(DE3). The vanillin
biosynthesis operon was induced to express above mentioned three enzymes. The
expressed enzymes converted ferulic acid to vanillin.
- The level of vanillin produced by recombinant E. coli cell factory was quantified
by HPLC. pET22-GEF and pRSET-GEF systems produced 1.44 g/L and 1.17 g/L,
respectively.
- Determined optimal conditions for vanillin production by recombinant E. coli,
including:
o Ferulic acid oncentration: 3 g/L
o Cultivation time: 36 hours
o Cultivation media: LB
o IPTG inducer concentration: 0.5 mM
- Estimated fermentation procedure of the recombinant E. coli strain for vanillin
biosynthesis. The production of vanillin was 1.42 ± 0.13 (using flask) and 1.53 ± 0.06
(using Labfors fermenter)
- 100 gram of vanillin was recovered from cultivation media of recombinant E.
coli.
5. Products:
5.1. Education support:
Graduate level: Supported one student in the field of Applied Biology
- Student’s name: Ma Thi Trang. Title of thesis: “Construction of recombinant E.
coli strain for biosynthesis of vanillin from ferulic acid”.
Undergraduate level: Supported three students in the field of Biotechnology
- Student’s name: Le T. Quynh Hoa. Title of thesis “Construction of expression
vector harboring genes encoding for biosynthesis of vanillin in E. coli”.
- Student’s name: Nguyen T. Thu Huong. Title of thesis “Molecular cloning and
sequencing of gltA gene encoding citrate synthase from E. coli”.
- Student’s name: Hoang T. Thuy Quynh. Title of thesis “Cloning and sequencing
of fcs gene encoding feruloyl-coa synthase from Amycolatopsis sp. HR104”.
5.2. Academic publications: Two peer-review papers have been published.
- Ma Thi Trang, Luong Thi Thu Huong, Le Quynh Hoa, Duong Van Cuong
(2015), “Cloning, sequencing, and constructing the expression vector containing genes


encoding enzymes responsible for biosynthesis of vanillin from ferulic acid”, Vietnam
Journal of Agriculture and Rural Development, vol. 11, tr. 274-283.
- Duong Van Cuong, Le Thi Quynh Hoa (2016), “Biosynfthesis of vanillin from
ferulic acid using recombinant E. coli”, Vietnam Journal of Agriculture and Rural
Development, vol. 294, tr. 68-75.
5.3. Applied products:
- One procedure for metabolic engineering recombinant E. coli strain harboring
expression vector containing policistronic operon of gltA, fcs and ech genes
- Two recombinant E. coli BL21(DE3) strains harboring vector pRSETGEF/pET22-GEF capable of biosynthesis of vanillin from ferulic acid
- One procedure of biosynthesis and extraction of vanillin from ferulic acid
- 100 gram vanillin was recovered from fermentation media
6. Transfer alternatives, application institutions, impacts and benefits of research
results:
This project has estimated an active method to produce natural vanillin from the
cheap and available substrate ferulic acid. The results, including recombinant E. coli cell
factory and procedure of vanillin production, can be transferred to apply in institutions or
companies where basic equipments, including deep freezer, shaking incubator/fermenter,
were equipped.
Implementing institution
(Signature, Full name, and Stamp)

Date:
Coordinator
(Signature and Full name)


1
PHẦN 1: MỞ ĐẦU
Vanillin (3-methoxy-4-hydroxybenzaldehyde) là một chất thơm quan trọng được sử
dụng phổ biến trên thế giới trong công nghiệp thực phẩm, đồ uống, nước hoa, dược phẩm
dinh dưỡng [4]. Mức độ tiêu thụ vanillin hàng năm trên thế giới vào khoảng hơn 12000
tấn. Vanillin được sản xuất chủ yếu từ nguồn tách chiết vỏ quả loài lan Vanilla planifolia
và tổng hợp nhân tạo từ eugenol, lignin… Trong đó, vanillin được tách chiết từ thực vật
chỉ đáp ứng 1% nhu cầu thị trường, còn lại là tổng hợp hóa học. Giá trị kinh tế của vanillin
tự nhiên từ Vanilla planifolia có giá lên tới 4000 đôla một kilogam, trái lại vanillin nhân
tạo chỉ vào khoảng 15 đôla trên một kilogam [5]. Sự khác biệt lớn giữa giá trị của vanillin
tự nhiên với vanillin tổng hợp đã kích thích mối quan tâm của ngành công nghiệp hương
liệu để sản xuất ra vanillin tự nhiên.
Một số vi sinh vật có khả năng phân hủy acid ferulic để tạo ra vanillin. Điểu yếu
của các sinh vật tự nhiên là sau khi tổng hợp vanillin lại bị phân hủy thành các hợp chất
khác và quá trình lên men một số xạ khuẩn thườnggặp khó khăn bởi dịch nuôi cấy có độ
nhớt cao do sự sinh trưởng của hệ sợi nấm và bào tử. E. coli không gặp phải các nhược
điểm này. Trong các nguồn cơ chất có thể sử dụng để sinh tổng hợp vanillin, acid ferulic
được quan tâm vì chất này có nhiều trong thành tế bào của thực vật hai lá mầm nên có thể
thu từ các phế phụ phẩm nông nghiệp.
Từ các luận điểm trên, đề tài này được thiết kế nhằm tạo chủng E. coli tái tổ hợp
chứa các gene của con đường sinh tổng hợp vanillin từ axit ferulic có khả năng sản xuất ra
vanillin tự nhiên từ axit ferulic.


2
PHẦN 2: TỔNG QUAN TÀI LIỆU
Nghiên cứu tổng kết 91 tài liệu liên quan đến vấn đề nghiên cứu trong và ngoài
nước, bao gồm: (1) Giới thiệu về vanillin, nguồn gốc, đặc tính sinh học, vai trò của vanillin
trong sản xuất công nghiệp và đời sống. (2) Các con đường sinh tổng hợp vanillin. (3) các
phương pháp sản xuất vanillin. (4) tiềm năng ứng dụng công nghệ DNA tái tổ hợp trong
sản xuất vanillin.
-

-

-

-

Hình 2.1: Con đường sinh tổng hợp vanillin từ acid ferulic
Con đường sinh tổng hợp vanillin theo thiết kế của đề tài được minh họa trên hình
2.1. Để tổng hợp vanillin theo con đường tái tổ hợp cần tách dòng các gene mã hóa cho
enzyme có khả năng phân giải cơ chất thành vanillin từ vi sinh vật đã biết, sau đó đưa gene
đó vào vector biểu hiện, biến nạp vào tế bào vật chủ thích hợp cho phép sự biểu hiện. Các
gen mã hóa enzyme sinh tổng hợp vanillin được xác định là gene fcs mã hóa enzyme
feruloyl-coA synthetase và gene ech mã hóa enzyme enoyl-CoA hydratase/aldolase. Vi
khuẩn E. coli được lựa chọn mang các gene mã hóa enzyme sinh tổng hợp vanillin, tuy
nhiên các tế bào E. coli mang vector tái tổ hợp chứa 2 gene fcs và ech trong điều kiện có
acid ferulic sẽ tạo ra vanillin và có hiện tượng tích lũy acety-CoA trong tế bào. Hiện tượng
này sẽ làm giảm nồng độ vanillin tạo thành và thiếu hụt CoA cho phản ứng chuyển hóa
acid ferulic thành feruloyl-CoA, dẫn đến dư thừa cơ chất có thể gây ức chế phản ứng. Để
khắc phục vấn đề trên cần bổ sung thêm gen gltA mã hóa cho enzyme citrate synthase có
vai trò tăng cường tiêu thụ acetyl-CoA để tạo ra nhiều CoA từ đó giúp chuyển hóa tối đa
lượng acid ferulic. Như vậy để tăng cường hiệu suất sản xuất vanillin trong E. coli cần kết
hợp ba gen fcs, ech, gltA trên cùng một hệ thống vector biểu hiện trong điều kiện nuôi cấy
được tối ưu hóa.


3
PHẦN 3: MỤC TIÊU, ĐỐI TƢỢNG, PHẠM VI, CÁCH TIẾP CẬN, NỘI
DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU
3.1. Mục tiêu nghiên cứu
Mục tiêu của đề tài là sử dụng kĩ thuật di truyền để tạo ra chủng vi khuẩn E. coli tái
tổ hợp chứa các gene của con đường sinh tổng hợp vanillin từ axit ferulic có khả năng sản
xuất ra vanillin tự nhiên từ axit ferulic.
3.2. Đối tƣợng và vật liệu nghiên cứu
3.2.1. Các chủng vi sinh vật
Chủng Pseudomonas fluorescens VTCC-B-668 được cung cấp bởi phòng Bảo tàng
giống chuẩn Vi sinh vật – Viện Vi sinh vật và công nghệ sinh học, ĐHQGHN. Chủng
Amycolatopsis sp. HR104 được cung cấp bởi Ngân hàng giống chuẩn Đức DSMZ (mã số
chủng DSM 9991). Chủng vi khuẩn E. coli DH5α được cung cấp bởi hãng Thermo
Scientific. Chủng vi khuẩn E. coli BL21(DE3) được cung cấp bởi hãng Invitrogen.
3.2.2 Các vector tách dòng và biểu hiện
- Vector tách dòng pTZ57R/T (Thermo Scientific)
- Vector biểu hiện pRSET-A và pET22b(+) (Invitrogen)
3.2.3. Mồi khuếch đại các gen gltA, fcs và ech
Chúng tôi sử dụng các cặp mồi được thiết kế dựa vào trình tự các gen đã công bố
trên NCBI.
Bảng 3.1: Trình tự mồi khuếch đại gen
Tên mồi

Trình tự

gltA-F

5'TGAGCTCAGAAGGATATACATATGGCTGATACAAAA3'

gltA-R

5'AAAGCTTTTAACGCTTGATATCGCTTT3'

Ech-F

5'AGAATTCAGGAGGGCATCGCCATGAGCAACTACGA3'

Ech-R

5'GCGAGCTCTCAGCGTTTATACGCCTGCAG3'

Fcs-F

5'TAATGCGCAACCAGGGTCTG3'

Fcs-R

5'ACCGTCACAGAGTAGCCGCA3'


4
3.2.4. Hóa chất, thiết bị
Đề tài sử dụng các loại hóa chất tinh khiết chuyên dụng trong sinh học được cung
cấp bởi các hãng cung cấp hóa chất uy tín từ các nước Đức, Tây Ban Nha, Thụy Điển. Một
số sản phẩm được cung cấp bởi hãng Thermo Scientific như enzyme T4 ligase, kit tách
chiết DNA từ gel MEGA- spinTM Agarose Gel Extraction Kit, các enzyme giới hạn,
enzyme Taq DNA polymerase…
Các thiết bị sử dụng trong nghiên cứu bao gồm những thiết bị chuyên dụng và hiện
đại của phòng thí nghiệm Sinh học phân tử và công nghệ gen Viện Khoa học sự sống, Đại
học Thái Nguyên.
3.3. Phạm vi nghiên cứu
Địa điểm: Viện Khoa học sự sống, Đại học Thái Nguyên.
Thời gian: Đề tài được thực hiện từ tháng 1/2013 đến tháng 06/2016
3.4. Cách tiếp cận
Chúng tôi tiếp cận bằng cách tách dòng ba gene gltA, fcs và ech từ một số chủng vi
sinh vật cho hiệu suất tổng hợp vanillin cao dựa vào các tài liệu đã báo cáo trước đó, trong
đó điển hình là Amycolatopsis sp. và P. fluorescens. Ba gene này được đưa vào vector biểu
hiện pET22b(+) và pRSET-A để cảm ứng sinh tổng hợp vanillin từ cơ chất axit ferulic.
3.5. Nội dung nghiên cứu
1. Tách dòng gene
2. Thiết kế vector biểu hiện mang các genes gltA, ech và fcs
3. Đưa vector vào tế bào chủ, cảm ứng biểu hiện các gene đích
4. Phân tích vanillin sản phẩm tạo thành
5. Xác định hệ thống vector/vật chủ tối ưu
6. Xác định điều kiện nuôi cấy thích hợp nhất
7. Thử nghiệm và tối ưu quy trình lên men


5
3.6. Phƣơng pháp nghiên cứu
Các phương pháp sinh học phân tử
Đề tài sử dụng một số kỹ thuật sinh học phân tử trong tách dòng và thiết kế vector
biểu hiện bao gồm:
- Tách chiết DNA tổng số từ vi sinh vật
- Điện di trên gel agarose
- PCR
- Cắt DNA bằng enzyme giới hạn
- Nối DNA bằng enzyme T4 ligase
- Thu nhận DNA từ gel agarose
- Biến nạp E. coli bằng sốc nhiết
- Giải trình tự DNA
- Cảm ứng biểu hiện bằng IPTG
- Phân tích SDS-Page
Phương pháp phân tích vanillin
Vanillin sản phẩm tạo thành từ axit ferulic dưới sự xúc tác của các enzyme
feruloyl-CoA synthase và enoyl-CoA hydratase/aldolasedo E. coli tái tổ hợp tạo ra sẽ được
phân tích định tính và định lượng bằng phương pháp HPLC.
Phương pháp lên men và thu nhận vanillin thành phẩm
Lên men E. coli sinh tổng hợp vanillin bổ sung cơ chất axit ferulic được thực hiện
theo hai phương pháp nuôi lắc bằng bình tam giác và sử dụng hệ thống lên men Labfos.
Vanillin sản phẩm được thu nhận theo phương pháp của Krueger có cải tiến.


6
PHẦN 4: KẾT QUẢ VÀ THẢO LUẬN
4.1. Tách dòng và giải trình tự các gene mã hóa các enzyme xúc tác con đƣờng sinh
tổng hợp vanillin từ axit ferulic
4.1.1. Tách dòng gene gltA từ E. coli DH5α
Gene gltA tách dòng từ vi khuẩn E. coli DH5α được xác định trình tự có kích thước
1284 bp. Vị trí cắt của enzyme giới hạn ở 2 đầu của gene được bảo toàn. Kết quả phân tích
NCBI BLAST cho thấy trình tự gene gltA tách dòng có độ tương đồng 100% với trình tự
gene gltA của E. coli sp. K-12 MC4100 mã số HG7388671. Trình tự gene gltA được dịch
mã in silico cho thấy gene được dịch mã thành công, đảm bảo cho sự biểu hiện của gene
này trong E. coli.
4.1.2. Tách dòng gene ech từ P. fluorescens VTCC-B-668
Kết quả giải trình tự gen ech ở plasmid pTZ-ech cho thấy bộ ba mở đầu ATG và
bộ ba kết thúc TGA được bảo toàn, kích thước đoạn gen là 831 bp bằng với kích thước gen
ech dùng để thiết kế mồi, vị trí cắt của enzyme giới hạn 2 đầu gene được giữ nguyên và
không đột biến. Như vậy các vị trí quan trọng thiết kế trong mồi đều được bảo toàn đây là
cơ sở đảm bảo cho công việc tiếp theo có thể thành công và gen ech có thể biểu hiện trong
vi khuẩn E. coli.
4.1.3. Tách dòng gene fcs từ Amycolatopsis sp. HR104
Gene fcs có độ dài 1476 bp có bộ ba mã mở đầu (ATG) và mã kết thúc (TGA) được
bảo toàn. Dịch mã in silico gene fcs tách dòng không xuất hiện mã kết thúc giữa gene.
Gene fcs tách dòng từ Amycolatopsis sp. HR104 tương đồng 99% với chủng Amycolatopsis
sp. HR167 trên Genebank (mã số AJ290449.1). Như vậy đã tách dòng thành công gene fcs
có thể sử dụng để thiết kế vector biểu hiện.
4.2 và 4.3. Thiết kế hai vector biểu hiện chứa 3 gen gltA, ech, fcs
Các phương pháp sinh học phân tử cơ bản được sử dụng để tạo vector tái tổ hợp
mang 3 gen gltA, ech, fcs trên nền tảng vector pET22b(+) và pRSET-A. Kết quả thu được
hai vector tái tổ hợp có cấu trúc như sau:
T7 terminator
HindIII (174)

gltA

pBR322 origin

ech

pET22-GEF

EcoRI (2331)

9420 bp

fcs

lacI

BamHI (4121)

T7 promoter

Vector pET-GEF

Vector pRSET-GEF

Hình 4.1: Cấu trúc hai vector tái tổ hợp


7
4.4. Sinh tổng hợp vanillin từ axit fefulic sử dụng E. coli tái tổ hợp làm tế bào chủ
4.4.1. Ảnh hưởng của nồng độ axit ferulic đến sinh trưởng E. coli
Nồng độ axit ferulic cao gây ảnh hưởng xấu đến sinh trưởng của E. coli [3], [5]. Để
tối ưu hóa năng suất sinh tổng hợp vanillin từ axit ferulic trước hết phải xác định được
nồng độ axit ferulic tối đa bổ sung vào môi trường nuôi cấy mà không ảnh hưởng đến sinh
trưởng tế bào. Dải nồng độ axit ferulic ban đầu được lựa chọn thử nghiệm nằm trong
khoảng 1 g/L đến 5 g/L căn cứ theo một số nghiên cứu trước [3], [5]. Axit ferulic được bổ
sung vào dịch nuôi cấy khi OD260nm đạt 0.6 và nuôi tiếp 36 tiếng, là khoảng thời gian nuôi
cấy có thể sinh tổng hợp vanillin tối đa [3].

Hình 4.2: Ảnh hưởng của nồng độ axit ferulic ban đầu với sinh trưởng của E. coli tái tổ
hợp mang vector pET22-GEF
Kết quả trên hình 4.2 cho thấy nồng độ axit ferulic 3 g/L là nồng độ cao nhất có thể sử
dụng mà ít gây ảnh hưởng đến sinh trưởng của tế bào E. coli. Kết quả này phù hợp với công bố
trước [3]. Nồng độ 3 g/L axit ferulic được lựa chọn cho các bước tối ưu hóa tiếp theo.
4.4.2. Xác định axit ferulic tồn dư và vanillin được tổng hợp bởi hệ thống pET22
Dòng E. coli tái tổ hợp chủng BL21(DE3) mang vector pET22-GEF được sử dụng
để sinh tổng hợp vanillin từ acid ferulic. Kết quả thể hiện trên hình 4.3.

Hình 4.3: Phân tích HPLC động học sự chuyển hóa axit ferulic thành vanillin ở chủng E.
coli BL21(DE3) tái tổ hợp mang vector pET22-GEF.
(I) cơ chất ferulic axit và vanillin chuẩn; (II) sự chuyển hóa axit ferulic (FA) thành vanillin (VA)
sau 12 giờ nuôi cấy; (III) sự chuyển hóa FA thành VA sau 36 giờ nuôi cấy.Axit ferulic (3 g/L) và
IPTG (1 mM) được bổ sung vào dịch nuôi cấy tại thời điểm 4h khi OD600nm đạt 0.4


8
Kết quả ở hình 4.3 cho thấy các đỉnh tương ứng với hai chất chuẩn ferulic acid và
vanillin thể hiện rõ ràng. Hình 4.3.II và III cho thấy lượng acid ferulic bổ sung vào dịch
nuôi cấy bị giảm đi theo thời gian do được sử dụng làm cơ chất để chuyển hóa thành
vanillin. Lượng vanillin sản phẩm được tạo thành tăng tương ứng theo thời gian. Kết quả
này cho thấy hệ thống sinh tổng hợp vanillin từ cơ chất axit ferulic sử dụng tế bào E. coli
tái tổ hợp do chúng tôi thiết kế đã hoạt động thành công.
4.5. Ảnh hƣởng của các điều kiện nuôi cấy lên năng suất sinh tổng hợp vanillin
Các điều kiện nuôi cấy có ảnh hưởng đến hiệu suất sinh tổng hợp vanillin từ axit
ferulic. Chúng tôi thử nghiệm một số điều kiện bao gồm các loại môi trường nuôi cấy,
nồng độ chất cảm ứng và thời gian nuôi cấy.
4.5.1. Ảnh hưởng của thời gian nuôi cấy
Trong một số nghiên cứu trước [3], [7] các tác giả đã tìm ra thời gian nuôi cấy tối ưu
cho sinh tổng hợp vanillin bằng E. coli tái tổ hợp là 36 tiếng. Tuy nhiên, hệ vector được sử
dụng trong các nghiên cứu đó dựa trên pBAD và pBluescript khác với các hệ thống pRSET
và pET của đề tài này, vì vậy chúng tôi tiến hành đánh giá lại thời gian nuôi cấy tối ưu.

Hình 4.4: Ảnh hưởng của thời gian nuôi cấy tới khả năng sinh trưởng và sinh tổng hợp
vanillin của chủng E. coli tái tổ hợp.
Kết quả trên hình 4.4 cho thấy ở mốc 12h sinh trưởng tế bào đạt mức cao nhất tuy
nhiên lượng vanillin tạo thành còn thấp. Từ 12h trở đi sinh trưởng tế bào giảm dần. Tại
thời điểm 36h mặc dù sinh trưởng tế bào ở mức thấp nhưng hàm lượng vanillin được tạo
thành và tích tụ đạt mức tối đa. Nuôi thêm lên mốc thời gian 42h hàm lượng vanillin giảm
đi do mối tương quan giữa lượng vanillin được sinh tổng hợp với lượng vanillin bị phân
hủy đã trở nên bất lợi trong khi sinh trưởng tế bào đã đạt mức thấp nhất. Kết quả này đồng


9
thuận với các nghiên cứu trước [3], [7]. Điều này cho thấy yếu tố thời gian nuôi cấy không
chịu sự chi phối của các hệ vector khác nhau mà do bản chất sinh học của tế bào vật chủ, ở
đây là E. coli, và bản chất hóa học của vanillin.
Thời gian nuôi 36h được lựa chọn cho các bước tiếp theo.
4.5.2. So sánh các môi trường LB, M9 và 2YT
Các nghiên cứu trước đã cho thấy thành phần môi trường có ảnh hưởng tới sinh
tổng hợp vanillin. Trong nghiên cứu này chúng tôi thử nghiệm 3 loại môi trường bao gồm
môi trường tiêu chuẩn LB, môi trường tối thiểu nghèo carbon M9 và môi trường giàu dinh
dưỡng 2YT.

Hình 4.5: So sánh khả năng sinh trưởng và sinh tổng hợp vanillin của
E. coli tái tổ hợp trên các môi trường LB, M9 và 2YT.

Hình 4.5 cho thấy sinh trưởng của E. coli thấp nhất ở môi trường tối thiểu M9 đồng
thời tỉ lệ thuận với lượng vanillin tạo thành. Tuy nhiên, ở môi trường giàu dinh dưỡng
2YT, mặc dù sinh trưởng tế bào tốt hơn hai môi trường LB và M9 nhưng lượng vanillin tạo
thành lại không bằng LB. Kết quả này cho thấy môi trường cân bằng dinh dưỡng LB phù
hợp hơn trong việc nuôi cấy E. coli tái tổ hợp để sinh tổng hợp vanillin. Môi trường LB do
đó được lựa chọn cho các thí nghiệm tiếp theo.
4.5.3. Ảnh hưởng của nồng độ chất cảm ứng IPTG
Ở các thí nghiệm trước chúng tôi sử dụng nồng độ IPTG 1 mM theo đề xuất của
nhà cung cấp vector. Trong thí nghiệm này chúng tôi bố trí dãy nồng độ IPTG nhằm tìm ra
nồng độ tối thiểu đáp ứng được nhiệm vụ cảm ứng biểu hiện các gene đích gltA, ech và fcs
xúc tác sinh tổng hợp vanillin.


10

Hình 4.6: Ảnh hưởng của nồng độ IPTG đến sinh tổng hợp vanillin.
Kết quả trên hình 4.6 cho thấy lượng vanillin tạo thành cao nhất đạt 1.6 g/L khi
được cảm ứng ở nồng độ IPTG 2 mM. Tuy nhiên, nồng độ IPTG 0.5 mM cũng tạo thành
lượng vanillin lên tới 1.52 g/L, vượt trội hoàn toàn so với mức 0.7 g/L ở nồng độ IPTG 0.2
mM. Mức chênh lệch của lượng vanillin sản phẩm cảm ứng bởi nồng độ IPTG 0.5 mM và
2 mM là không thật sự lớn, trong khi lượng IPTG cần dùng chênh nhau 4 lần. Vì vậy,
chúng tôi sử dụng nồng độ IPTG 0.5 mM cho các bước tiếp theo.
4.6. So sánh hiệu suất sinh tổng hợp vanillin giữa hai hệ vector pET22 và pRSET
Dựa trên sự phân tích chuyển hóa ở chủng E. coli BL21(DE3)/pET-GEF, chúng tôi
đã tiến hành phân tích tương tự với chủng E. coli BL21(DE3) tái tổ hợp mang vector
pRSET-GEF. Hiệu quả chuyển hóa axit ferulic thành vanillin giữa hai hệ thống vector
được so sánh trên hình 4.7.

Hình 4.7. So sánh hiệu suất sinh tổng hợp vanillin từ cơ chất axit ferulic sử
dụng các chủng E. coli tái tổ hợp mang vector pET22-GEF và pRSET-GEF

Hình 4.7 cho thấy hệ thống biểu hiện trên nền tảng vector pET22b(+) có hiệu suất
sinh tổng hợp vanillin đạt 1.44 g/L cao hơn so với mức 1.17 g/L của vector pRSET-A.
Hiệu suất sinh tổng hợp vanillin trong nghiên cứu của chúng tôi cao hơn mức 580 mg/L [7]
khi gene gltA chưa được sử dụng. Dữ liệu này góp phần khẳng định vai trò của gene gltA
trong sinh tổng hợp vanillin bằng E. coli tái tổ hợp vì gene này giúp tái sử dụng acetylCoA theo chu trình [3].


11
4.7. Lên men E. coli sinh tổng hợp vanillin và thu hồi sản phẩm
Các điều kiện lên men có ảnh hưởng đến năng suất sinh tổng hợp vanillin. Chúng
tôi thử nghiệm hai quy trình lên men.
4.7.1. So sánh hai quy trình lên men

Hình 4.8: So sánh hiệu suất sinh tổng hợp vanillin giữa hai phương pháp lên men
Kết quả trên hình 4.8 cho thấy hiệu suất sinh tổng hợp vanillin của hai phương
pháp (1) sử dụng bình tam giác và (2) sử dụng hệ thống Labfors lần lượt đạt mức 1.42 ±
0.13 và 1.53 ± 0.06. Kết quả này cho thấy hệ thống lên men Labfors cho hiệu suất lên men
cao hơn và ổn định hơn so với hệ thống sử dụng bình tam giác. Tuy nhiên, trong các phòng
thí nghiệm có điều kiện hạn chế, việc sử dụng bình tam giác và mắc lắc ổn nhiệt thông
dụng để lên men E. coli tái tổ hợp sinh tổng hợp vanilin là lựa chọn hiệu quả.
4.7.2. Thu hồi sản phẩm vanillin
Vanillin trong dịch nổi được tinh chế theo phương pháp của Krueger [2] có cải tiến.
Tinh thể vanillin được thu nhận, nghiền mịn và bảo quản ở 4oC.

Hình 4.9: Tinh thể vanillin thu nhận được sau khi chiết xuất


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×