Tải bản đầy đủ

NGHIÊN CỨU TRÌNH TỰ MỘT SỐ GEN ĐỘC LỰC CỦA YERSINIA PESTIS VÀ PHÁT TRIỂN KỸ THUẬT MULTIPLEX PCR XÁC ĐỊNH YERSINIA PESTIS GÂY BỆNH Ở VIỆT NAM

TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

NGHIÊN CỨU TRÌNH TỰ MỘT SỐ GEN ĐỘC LỰC CỦA
YERSINIA PESTIS VÀ PHÁT TRIỂN KỸ THUẬT MULTIPLEX PCR
XÁC ĐỊNH YERSINIA PESTIS GÂY BỆNH Ở VIỆT NAM
Đinh Thị Thu Hằng*; Nguyễn Thái Sơn**; Nguyễn Văn An**
Cao Thị Dinh***; Triệu Thị Nguyệt***
TÓM TẮT
Mục tiêu: xác định trình tự đầy đủ gen ypo2088 (trên nhiễm sắc thể [NST]), pla, caf1 (trên
hai plasmid độc lực là pPCP1 và pMT1) của chủng vi khuẩn (VK) Yersinia pestis Yp1 phân lập
ở Việt Nam và phát triển kỹ thuật PCR đa mồi xác định nhanh, chính xác Y. pestis gây bệnh.
Vật liệu và phương pháp: chủng Y. pestis Yp1 có đầy đủ độc lực được lưu giữ tại “Ngân hàng
Chủng và Gen” của Học viện Quân y. Toàn bộ chiều dài gen ypo2088, pla và caf1 sau khi
khuếch đại chính xác được tách dòng và phân tích trình tự. Từ kết quả phân tích trình tự kết
hợp với trình tự các chủng tham chiếu trên Ngân hàng Gen, 3 cặp mồi là ypo2088F/R, plaF/R
và caf1F/R đã thiết kế để khuếch đại đồng thời gen đích tương ứng trong phản ứng PCR đa
mồi xác định VK dịch hạch gây bệnh. Kết quả và kết luận: tách dòng và phân tích trình tự đầy
đủ 3 gen là ypo2088, pla và caf1 của chủng VK Y. pestis Yp1 phân lập ở Việt Nam. Xác định
được 1 đột biến sai nghĩa trên gen pla, hai gen còn lại có mức độ tương đồng 100% khi so
sánh với trình tự tham chiếu (mã số CP000900). Kết quả một lần nữa chứng minh, trình tự gen
ypo2088, pla và caf1 rất ổn định, không có sự khác biệt đáng kể giữa các chủng Y. pestis.

Trình tự đầy đủ 3 gen này đã được đăng ký trên Ngân hàng Gen Quốc tế với mã số lần lượt là
KM880027, KM880025 và KM880026. Đã thiết kế thành công phản ứng PCR đa mồi khuếch
đại đồng thời 3 gen đích xác định chính xác VK dịch hạch gây bệnh.
*

Từ khóa: Caf1 (F1 capsule antigene); Độc lực; PCR đa mồi; Yersinia pestis.

Study on the Complete Sequences of Virulence Genes of Yersinia
Pestis and Development of a Multiplex PCR Assay for Detection of
Pathogenic Yersinia Pestis in Vietnam
Summary
Objectives: Sequence analysis of the entire ypo2088 gene (within bacterial chromosome),
pla and caf1 genes (on the virulence plasmids pPCP1 and pMT1) of the pathogenic Yersinia
pestis strain Yp1 isolated in Vietnam and development of a multiplex PCR assay for rapid and
accurate detection of pathogenic Y. pestis. Materials and methods: Y. pestis strain Yp1 with full
virulence was provided by Strain and Gene Bank of Vietnam Military Medical University. Total DNA
was extracted from culture media following autoclaved inactivation. Subsequently, full-length ypo2088,
* Học viện Quân y
** Bệnh viện Quân y 103
*** Đại học Khoa học tự nhiên
Người phản hồi (Corresponding): Đinh Thị Thu Hằng (hangdinhbio@gmail.com)
Ngày nhận bài: 02/03/2015; Ngày phản biện đánh giá bài báo: 16/03/2015
Ngày bài báo được đăng: 31/03/2015

57


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015
pla and caf1 genes were amplified using high-fidelity PCR. The purified PCR products were
cloned in pJET1.2/blunt by conventional recombinant methods and they were sequenced from
both ends. According to these sequencing results and the reference sequences in Genbank,
three primer pairs, including ypo2088F/R, plaF/R and caf1F/R, were designed in a multiplex PCR
assay for detection of pathogenic Y. pestis. Results and conclusions: One missense mutation
was identified in pla gene, two remaining genes were found to be 100% similar in sequence to
the reference sequences of Y. pestis Angola (accession number KP000900). These results again
demonstrate that ypo2088, pla, caf1 gene sequences are very conservative, with no significant
difference among Y. pestis strains. The complete sequences of these genes were submitted to
Genbank with accession number KM880027, KM880025 and KM880026, respectively. A multiplex
PCR assay that amplifies these three target genes was successfully developed for rapid and
accurate detection of pathogenic Y. pestis.

*

Key words: Caf1 (capsule fraction 1 gene); Multiplex PCR; pla (plasminogen gene);
Yersinia pestis.

ĐẶT VẤN ĐỀ
Y. pestis là VK Gram âm, không sinh bào
tử thuộc chi Yersinia - họ Enterobacteriaceae.
Trong 11 loài thuộc chi Yersinia, chỉ có
ba loài gây bệnh ở người là Y. pestis,
Y. pseudotuberculosis và Y. enterocolitica.
Loài nguy hiểm nhất, Y. pestis gây bệnh
dịch hạch và viêm phổi cấp tính phân biệt
với hai loài còn lại [8, 10]. Tiềm năng hủy
diệt của dịch hạch đã được chứng minh
qua thùc tÕ lµ 200 triệu ca tử vong trong
lịch sử, dẫn đầu danh sách các bệnh
truyền nhiễm nguy hiểm. Theo Tổ chức Y
tế Thế giới, từ 1989 đến 2003, thế giới đã
ghi nhận 38.310 ca nhiễm và 2.845 ca tử
vong, tập trung chủ yếu ở châu Phi và
châu Á - nơi thiếu hoặc chưa đáp ứng
đầy đủ của hệ thống giám sát, các cơ sở
chẩn đoán hay báo cáo dịch [5]. Đặc biệt,
những năm gần đây, mối quan tâm đối
với VK dịch hạch được đặt ở mức cao, do
khả năng sử dụng Y. pestis như một loại
vũ khí sinh học [8].
Trên thế giới, toàn bộ hệ gen của
một số chủng chuẩn như Y. pestis KIM5
58

(thuộc về biovar Mediaevalis), CO92 (chủng
biovar Orientalis) đã được giải trình tự,
tạo thuận lợi cho nghiên cứu, xác định
Y. pestis [9]. Genome của Y. pestis
(chủng CO92) bao gồm một “NST” 4,65
Mb và ba plasmid lần lượt là pLcr, pPCP1
và pMT1. Ngoài các sản phẩm do hệ gen
trên NST, yếu tố độc lực của Y. pestis là
do gen trên các plasmid này đảm nhiệm.
Trong đó, pPCP1 và pMT1 là 2 plasmid
được xác định chỉ có riêng ở Y. pestis [8].
pPCP1 (kích thước 9,6 kb), có gen quan
trọng là pla mã hóa chất hoạt hóa
plasminogen Pla, đóng vai trò quan trọng
đối với khả năng xâm nhập của Y. pestis
vào cơ thể qua da [4]. Plasmid còn lại
là pMT1 có kích thước tương đối lớn
(110 kb) tiêu biểu với các gen mã hóa
cho kháng nguyên vỏ F1, gen biểu hiện
phospholipase D (PID), cả hai đều có vai
trò trong lây lan dịch hạch [8].
Ở Việt Nam, bệnh dịch hạch còn xuất
hiện rải rác ở khu vực Tây Nguyên như
Gia Lai, ĐắK Lắk [5]. Nghiên cứu về
Y. pestis cũng như bệnh dịch hạch chủ
yếu tập trung về dịch tễ học, thống kê,


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

giám sát bệnh trên cơ sở các vùng sinh
thái. Những kết quả nghiên cứu về phân
tử VK dịch hạch còn hạn chế và đơn lẻ
trên một số gen đích [1, 5]. Nghiên cứu
này tách dòng và giải trình tự toàn bộ gen
đặc trưng trên NST - ypo2088 và gen độc
lực trên plasmid pPCP1, pMT1 tương
ứng là pla và caf1 của chủng Y. pestis
Yp1 phân lập ở Việt Nam. Đồng thời,
nhóm tác giả đã phát triển kỹ thuật PCR
đa mồi (multiplex PCR - mPCR) sử dụng
3 gen đích này để xác định chính xác VK
dịch hạch có độc lực trong tự nhiên.
Nghiên cứu đã góp phần làm phong phú
thêm những kết quả về đa dạng di truyền
các gen độc lực của VK dịch hạch cũng
như cung cấp công cụ phân tử hữu hiệu
cho phép chẩn đoán nhanh và chính xác
Y. pestis có độc lực.
VẬT LIỆU VÀ PHƯƠNG PHÁP
NGHIÊN CỨU
1. Chủng vi khuẩn.
Chủng Y. pestis Yp1 có độc lực và
chủng đối chứng âm E. coli ATCC 25922
do Ngân hàng Chủng và Gen của Học
viện Quân y cung cấp, xác định đặc điểm

hình thể, tính chất sinh vật hóa học bằng
card định danh GN46 (Vitek 2 - BioMérieux)
và thử nghiệm độc lực trên chuột nhắt
trắng để khảo sát khả năng gây chết
hàng loạt.
2. Tách chiết ADN và PCR.
Chủng VK được bất hoạt ở điều kiện
121oC/20 phút, sau đó tách ADN tổng số
theo quy trình của nhà sản xuất (ADN
genome QIAGen minikit). Thiết kế các
cặp mồi tách dòng dựa trên trình tự gen
ypo2088, pla và caf1 trên Ngân hàng Gen
và được tổng hợp bởi IDT (Mỹ). Sử dụng
sinh phẩm Phusion High-Fidelity ADN
polymerase (Thermo scientific) để phân
lập gen đích với chu trình nhiệt, nhiệt độ
gắn mồi TaoC và thời gian kéo dài chuỗi
như sau: biến tính 98oC trong 30 giây,
khuếch đại 30 - 32 chu kỳ (98oC, 8 giây;
TaoC, 20 giây; 72oC, 30 - 35 giây), sau đó
hoàn thành kéo dài chuỗi ở 72º trong
6 phút. Trong đó, nhiệt độ gắn mồi
Ta oC và thời gian kéo dài chuỗi phụ
thuộc vào trình tự mồi và kích thước
sản phẩm.

Bảng 1: Thông tin các mồi sử dụng trong nghiên cứu.
TÊN MỒI

MỤC ĐÍCH

TRÌNH TỰ (5’-3’)

NHIỆT ĐỘ GẮN
KÍCH
MỒI (Ta: oC) THƯỚC (bp)

PCR/giải
trình tự
ypo2088F/BamHI

PCR

GGGATCCGTGATGATTAAGTTCATGCT

52

719

PCR/giải
trình tự

CCTCGAGGTCTGTATTGCTGAGAAAAG

52

719

plaF/EcoRI

PCR

CGAATTCGCAGAGAGATTAAGGGTGT

57

1019

plaR/XhoI

PCR

ACTCGAGTTCCACAGACATCCTCCC

57

1019

caf1F/BamHI

PCR

AGGATCCGGACACAAGCCCTCTCTAC

60

654

ypo2088R/XhoI

59


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015
caf1R/XhoI

PCR

TCTCGAGCGAGGGTTAGGCTCAAAGT

60

654

pJET1.2_F

Giải trình tự

CGACTCACTATAGGGAGAGCGGC

58

-

pJET1.2_R

Giải trình tự

AAGAACATCGATTTTCCATGGCAG

58

-

GGATGAGATAACGCGGGTGT-F

56

103

56

438

56

271

mPCR
ypoF1/R1

mPCR

AGAGAATCGTGATGCCGTCC-R
plaF1/R1

mPCR

CGGGATGCTGAGTGGAAAGT-F
ATTACCCGCACTCCTTTCGG-R

cafF1/R1

mPCR

CGCTTACTCTTGGCGGCTAT-F
GCTGCAAGTTTACCGCCTTT-R

3. Tách dòng và giải trình tự gen.

4. Multiplex PCR.

Tiến hành nối ghép trực tiếp sản phẩm

Tham khảo trình tự các gen ypo2088,

PCR tinh sạch của 3 gen ypo2088, pla

pla và caf1 của chủng VK dịch hạch trên

và caf1 với vector tách dòng pJET1.2/blunt

Ngân hàng Gen kết hợp với kết quả giải

nhờ T4-ligase (Thermo scientific). Sản

trình tự trong nghiên cứu này, 3 cặp mồi

phẩm nối ghép được biến nạp vào tế

tương ứng với các gen đích trên được

bào khả biến E. coli DH5 (Invitrogen)

thiết kế trong phản ứng PCR đa mồi xác

bằng phương pháp sốc nhiệt. Tiến hành
kiểm tra các thể tái tổ hợp bằng PCR
khuẩn lạc (PCR colony), cắt bằng enzym
hạn chế AvaI và XbaI (Thermo scientific).
Xác đinh trình tự các gen đích theo cả
hai chiều theo phương pháp Sanger
với các mồi trên vector pJET1.2F/R và
mồi khuếch đại (bảng 1). Sử dụng phần

định Y. pestis có độc lực (bảng 1). Thành
phần mPCR như sau: 1,2X Dream Taq
Buffer; 0,25 mM dNTPs; MgCl2 0,6 mM;
0,25 μM mồi xuôi, mồi ngược mỗi loại;
Dream Taq 0,8U; ~ 10 ng ADN khuôn,
điều chỉnh H2O đủ thể tích 25 μl. Chu
trình nhiệt: biến tính 94oC/4 phút, tiếp
theo là 30 chu kỳ (94oC/30 giây; 56oC/30
giây; 72oC/30 giây), sau đó hoàn thành

mềm Bioedit và Genious R7 để xử lý,

kéo dài chuỗi ở 72º trong 6 phút. Sản

nối ghép tạo trình tự toàn bộ gen

phẩm mPCR được điện di kiểm tra trên

ypo2088, pla, caf1, so sánh và phân tích

gel agarose 1,5% TBE 0,5X; nhuộm ethidium

trình tự đã xác định với trình tự trên

bromide và quan sát bằng hệ thống soi

Ngân hàng Gen.

gel Dolphin-DOC.

60


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

KẾT QUẢ NGHIÊN CỨU VÀ BÀN LUẬN
1. Tách dòng và giải trình tự toàn bộ gen ypo2088, pla và caf1.

Hình 1: Kết quả kiểm tra sản phẩm tổng hợp các gen đích bằng Phusion ADN
polymerase trên gel agrose 1,2%.
a) M: Thang ADN chuẩn 100 bp (Thermo Scientific); 1: Sản phẩm tổng hợp gen ypo2088.
b) M: Thang ADN chuẩn 1 kb (Thermo Scientific); 1, 2: Sản phẩm tổng hợp gen pla, caf1.

ADN tổng số của chủng Y. pestis Yp1
được dùng để phân lập gen ypo2088, pla
và caf1 bằng PCR sử dụng Phusion HighFidelity ADN polymerase với các cặp mồi
tách dòng tương ứng. Điện di kiểm tra
sản phẩm PCR trên gel agarose 1,2%
(hình 1) cho thấy, 3 sản phẩm khuếch đại
rất đặc hiệu, thể hiện bằng các band đậm,
rõ nét, không có band phụ, kích thước
tương đương với tính toán lý thuyết.
Theo như thiết kế, nếu khuếch đại
thành công, các gen này sử dụng cặp mồi
là ypo2088F/R, plaF/R và cafF/R sẽ cho
sản phẩm có kích thước tương ứng là
645, 1019 và 654 bp, tương đương với
kích thước sản phẩm PCR trên bản gel
điện di. Việc lựa chọn gen đặc trưng
của Y. pestis trên NST là ypo2088 và gen
độc lực pla, caf1 trên plasmid được tham
61

khảo từ một số nghiên cứu trên thế giới
[4, 7, 10]. Nhóm nghiên cứu đã phân lập
toàn bộ chiều dài của các gen này để
phân tích trình tự của chủng VK dịch hạch
có độc lực ở Việt Nam nhằm xác định có
sự sai khác nào trong trình tự nucleotid
với các chủng Y. pestis có độc lực trên
thế giới.
Như vậy, từ kết quả điện di kiểm tra
sản phẩm PCR khuếch đại các gen đích
và gen độc lực của Y. pestis như trên có
thể kết luận, bước đầu đã khuếch đại
thành công gen ypo2088, pla và caf1 của
chủng Y. pestis Yp1 phân lập ở Việt Nam.
Sau khi tinh sạch, các sản phẩm PCR
này được gắn vào vector tách dòng
pJET1.2/blunt. Plasmid tái tổ hợp chứa
gen đích mong muốn, kiểm tra bằng PCR
colony và enzym hạn chế AvaI và XbaI
(hình 2).


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

Hình 2: Kết quả kiểm tra ADN plasmid từ các dòng khuẩn lạc trên gel agarose 1,2%.
a. Kết quả PCR colony, M: Thang ADN chuẩn 1 kb (Thermo Scientific); 1 - 4: Các dòng khuẩn
lạc 1 - 4 với gen pla; 5 - 8: Các dòng khuẩn lạc 1 - 4 với gen caf1.
b. Kết quả cắt kiểm tra bằng cặp enzym hạn chế AvaI và XbaI, M: Thang ADN chuẩn 1 kb
(Thermo Scientific); 1 - 4: Sản phẩm cắt trên các dòng khuẩn lạc 1 - 4 mang plasmid pJET1.2-pla.
c. Kết quả cắt kiểm tra bằng cặp enzyme hạn chế AvaI và XbaI, M: Thang ADN chuẩn 1 kb
(Thermo Scientific); 1, 2: Sản phẩm cắt trên các dòng khuẩn lạc 1, 2 mang plasmid pJET1.2-caf1.

Hình 2: minh họa kết quả kiểm tra các
thể tái tổ hợp chứa gen đích là pla và
caf1. Thực hiện PCR colony với cặp mồi
trên vector là pJET1.2F/R, theo tính toán
lý thuyết, nếu đoạn ADN gen đích gắn
được vào vector thành công thì tổng kích
thước sản phẩm PCR colony sẽ bằng
kích thước của gen đích và thêm chiều dài
118 bp (là kích thước đoạn ADN trên vector
được tính từ 2 đầu mồi pJET1.2F/R đến
đầu đa điểm cắt - Multiple Cloning Site).
Hình 2a cho thấy, với gen pla, có 3 dòng
khuẩn lạc là 1, 2 và 4 có sản phẩm band
rõ nét, kích thước khoảng 1,1 kb (tương
ứng với tính toán lý thuyết 1.137 bp).
Tương tự với gen caf1, kích thước sản
phẩm PCR colony là 772 bp, đúng với
trên hình điện di kiểm tra ở các dòng
khuẩn lạc 1 và 2. Kết quả cắt kiểm tra
plasmid tái tổ hợp bằng cặp enzym hạn
chế AvaI và XbaI cho các sản phẩm có
62

kích thước đúng như lý thuyết. Kết quả
này một lần n÷a khẳng định dòng khuẩn
lạc 2 - 4 (với gen pla) và dòng khuẩn lạc
1, 2 (với gen caf1) chứa các gen đích
mong muốn (hình 2b), đối với vector chứa
gen pla, đường chạy số 2 - 4 cho 2 sản
phẩm có kích thước khoảng 2,9 kb (kích
thước của vector) và 1,1 kb (gen pla). Với
hình 2c của vector chứa gen caf1, sản
phẩm cắt kiểm tra là 3 band rõ nét có
kích thước đúng như tính toán trên cả
đường chạy số 1 và 2. Sở dĩ xuất hiện
2 band có kích thước khoảng 0,2 và
0,4 kb ngoài band 2,9 kb (vector) là do
trong trình tự gen caf1 chứa trình tự
nhận biết của XbaI. Như vậy, các dòng
khuẩn lạc 2 - 4 (đối với gen pla), dòng
1, 2 (đối với gen caf1) mang plasmid
chứa gen đích tương ứng. Các gen đích
này đã được tách dòng thành công trong
vector pJET1.2/blunt.


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

Kết quả giải trình tự các gen đích trên vector tách dòng cho thấy, gen ypo2088 và
caf1 của chủng Y. pestis Yp1 có mức độ tương đồng 100% so với các chủng tham chiếu
trên Ngân hàng Gen. Chỉ có một đột biến điểm được xác định ở gen pla (TC)836 khi
so sánh với trình tự gen tương ứng trên chủng Y. pestis Angola mã số CP000900 (vị trí
nucleotid đột biến được tính theo trình tự nucleotid gen pla chủng Y. pestis Angola).

Hình 3: So sánh trình tự nucleotid gen pla của chủng Y. pestis Yp1 với 4 chủng tham
chiếu trên Ngân hàng Gen (đoạn nucleotid có xảy ra đột biến). Các chủng tham chiếu
được ký hiệu theo thứ tự mã số, tên chủng/phân lập, dấu chấm biểu thị nucleotid
giống nhau, nếu có đột biến sẽ được biểu thị bằng các nucleotid.
Sự xuất hiện đột biến điểm này được
tìm thấy trên các chủng tham chiếu lựa chọn
là Y. pestis CO92, biovar Medievalis và
Kim5. Đây là đột biến sai nghĩa, làm thay
đổi axít amin isoleucine thành threonine.
Thay đổi từ axít amin không phân cực
(Isoleucine) thành axít amin phân cực
(Threonine) có ý nghĩa nhất định. Tuy nhiên,
để tìm hiểu thêm cần có các công trình
nghiên cứu tiếp theo về protein tái tổ hợp.
Như vậy, từ kết quả nghiên cứu có thể
kết luận, đã tách dòng và xác định trình tự
đầy đủ các gen ypo2088, pla và caf1 của
chủng Y. pestis Yp1 phân lập ở Việt Nam.
Trình tự các gen này đã được đăng ký
trên Ngân hàng Gen với mã số lần lượt là
KM880027, KM880025 và KM880026.
2. Thiết kế phản ứng multiplex PCR.
Phản ứng mPCR được thiết kế với 3
cặp mồi là ypo2088F/R, plaF/R và caf1F/R
63

để xác định sự có mặt của các gen tương
ứng đặc trưng cho Y. pestis gây bệnh.
Những chủng Y. pestis chứa đầy đủ các
gen này trong tự nhiên được xác định
đầy đủ độc lực. Để thực hiện phản ứng
mPCR, 3 cặp mồi phát hiện được thiết
kế có chiều dài và nhiệt độ gắn mồi tương
đương nhau. Nồng độ các cặp mồi
được tối ưu (0,25 mM mồi xuôi, mồi
ngược mỗi loại), sau khi thực hiện phản
ứng PCR đơn trên từng gen tương ứng.
Khảo sát gradient nhiệt độ gắn mồi từ
52 - 60oC, lựa chọn nhiệt độ gắn mồi
tối ưu là 56 oC. Sản phẩm phản ứng
mPCR khuếch đại đồng thời 3 gen đích
của VK dịch hạch có kích thước lần lượt
là 103, 438 và 271 bp xác định các gen
tương ứng ypo2088, pla và caf1, dễ dàng
phân biệt trên bản điện di agarose 1,5%
(hình 4).


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

canh khuẩn VK dịch hạch (với lượng
50 - 100 cfu/phản ứng). Kết quả mPCR với
mẫu Y1 không xuất hiện band đích nào,
cho thấy đây là mẫu âm tính với Y. pestis.
Còn mẫu Y2 xuất hiện đầy đủ 3 band có
kích thước đúng với mẫu đối chứng (+),
được xác định là mẫu Y. pestis có đầy
đủ độc lực.
Khi dịch bệnh xảy ra, việc xác định
nhanh và chính xác mầm bệnh nghi ngờ
rất cần thiết để tránh nhầm lẫn với các
loài không gây bệnh có quan hệ gần gũi
Hình 4: Hình ảnh điện di xác định VK
Y. pestis có độc lực bằng PCR đa mồi
trên gel agarose 1,5%.

[7]. Phương pháp PCR sử dụng đích gen

M: Marker 100 bp (Thermoscientific), ĐC (-):
Đối chứng âm sử dụng chủng E. coli ATCC
25922; ĐC(+): Đối chứng dương sử dụng
plasmid tái tổ hợp chứa các gen pla, caf1 và
ypo2088; Y1, Y2: Các mẫu cần kiểm tra.

giả trên thế giới đã xác định các vùng gen

Trong phản ứng mPCR này, đối chứng
âm được sử dụng là VK E. coli chủng
ATCC 25922 để kiểm tra phản ứng chéo.
E. coli là VK phân bố rộng rãi trong tự nhiên,
cùng họ VK đường ruột với Y. pestis.
Hình 4 cho thấy, ở mẫu đối chứng (-)
không xuất hiện bất kỳ band nào. Trong
khi đó, ở mẫu đối chứng dương là plasmid
tái tổ hợp chứa các gen ypo2088, pla,
caf1 thông qua tách dòng cho sản phẩm
mPCR là 3 band có kích thước đúng với
các đoạn gen tương ứng cần khuếch đại.
Mẫu kiểm tra là Y1 và Y2, đây là mẫu môi
trường đất gây nhiễm giả định. Với mẫu
Y1 là mẫu đất thông thường không gây
nhiễm và mẫu Y2 là mẫu đất có gây nhiễm
64

đặc trưng, gen độc lực cho Y. pestis để
chẩn đoán là lựa chọn khả thi. Một số tác
trên NST đặc trưng cho Y. pestis, từ đó
thiết kế cặp mồi đặc hiệu cho PCR và
chứng minh không xảy ra phản ứng chéo
với loài có quan hệ gần gũi [2, 8]. Những
gen đặc trưng này có ưu điểm: chúng đều
nằm trên NST (bền), chỉ có mặt trên VK
đích (tránh hiện tượng dương tính giả),
xuất hiện trên tất cả các chủng (loại bỏ
hiện tượng âm tính giả). Tuy nhiên, nhiều
nghiên cứu trước đây tập trung vào việc
xác định các gen độc lực trên hai plasmid
đặc trưng của Y. pestis là pPCP1 và
pMT1. Trên thực tế, trong nhiều trường
hợp các plasmid này không bền trong
thao tác di truyền, có những chủng tự
nhiên mất một hay nhiều hơn những
plasmid này [10]. Như vậy, việc xác định
các chủng Y. pestis có độc lực trong tự
nhiên cần kết hợp gen đích trên NST và


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

gen trên plasmid độc lực mới cho kết quả

xác định nhanh, chính xác VK Y. pestis có

chẩn đoán chính xác. Với phản ứng

độc lực trong tự nhiên.

mPCR này, nhóm tác giả đã sử dụng
đồng thời 3 cặp mồi xác định sự có mặt

KẾT LUẬN

của 3 gen đích là pla, caf1, ypo2088.

Đã tách dòng và giải trình tự thành

Trong đó, pla và caf1 là gen đích thường

công toàn bộ chiều dài 3 gen là ypo2088,

được sử dụng để xác định Y. pestis.

pla và caf1 của chủng VK Y. pestis Yp1

Ngoài ra, gen pla thường có 150 - 200

phân lập ở Việt Nam. Xác định được 1

bản copy/tế bào, chính đặc điểm đó đã

đột biến sai nghĩa (TC)836 làm thay đổi

tăng tính nhạy của phản ứng PCR [3].

axít amin (IsoleucineThreonine) trên

Điều quan trọng nữa, pla quyết định tính

gen pla, hai gen còn lại có mức độ tương

độc của Y. pestis bằng con đường lây truyền

đồng 100% khi so sánh với trình tự tham

qua da; các chủng VK thiếu mất gen pla

chiếu. Kết quả này phù hợp với những

có độc lực rất thấp [4]. Gen caf1 mã hóa

nghiên cứu trên thế giới cho thấy trình tự

kháng nguyên vỏ F1 (fraction 1), có tác

3 gen ypo2088, pla và caf1 rất bền vững,

dụng giúp cho Y. pestis không bị hấp thu

không có sự khác biệt đáng kể giữa các

bởi đại thực bào [8]. Việc xác định sự có

chủng Y. pestis. Thiết kế thành công phản

mặt của các gen này cho phép khẳng

ứng mPCR khuếch đại đồng thời 3 gen

định tính độc của chủng Y. pestis trong

đích, xác định chính xác VK dịch hạch có

tự nhiên. Gen đích đặc trưng thứ ba

độc lực, có ý nghĩa trong phát hiện sớm

được sử dụng trong công trình này thuộc

và dự phòng dịch bệnh này.

NST ypo2088 mã hóa cho một putative
methyltransferase, 1 trong 28 marker
được Zhou và CS xác định [10]. Trước
đây, các nhà khoa học chỉ sử dụng gen
pla để phát hiện Y. pestis trong các mẫu
lâm sàng. Tuy nhiên, nhiều nghiên cứu đã
chỉ ra, có một tỷ lệ các chủng Y. pestis bị
mất gen pla do nó định vị trên một
plasmid có kích thước tương đối nhỏ.
Vì vậy, việc sử dụng thêm ypo2088 - gen
đích nằm trên NST, đặc trưng cho Y. pestis
được ưu tiên lựa chọn, cho phép chẩn đoán
chính xác VK dịch hạch [4, 6]. Với kết quả
trên, phản ứng mPCR được thiết kế đã
65

TÀI LIỆU THAM KHẢO
1. Lê Thanh Hòa, Nguyễn Thị Bích Nga,
Nguyễn Thị Ngọc Dao, Đỗ Ngọc Khuê. Xây
dựng phương pháp chẩn đoán nhanh VK dịch
hạch (Yersinia pestis) từ mẫu đất và nước
nhiễm khuẩn. Tạp chí Nghiên cứu Y học.
2005, 38 (5), tr.1-6.
2. Chain P S G, Carniel E, Larimer F W
et al. Insights into the evolution of Yersinia
pestis through whole-genome comparison
with Yersinia pseudotuberculosis. Proceedings
of the National Academy of Sciences of the
United States of America. 2004, 101 (38),
pp.13826-13831.


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015
3. Leal N C, Almeida A M. Diagnosis of plague and identification of virulence markers in
Yersinia pestis by multiplex-PCR. Rev Inst Med Trop Sao Paulo. 1999, 41 (6), pp.339-342.
4. Matero P, Pasanen T, Laukkanen R et al. Real-time multiplex PCR assay for detection of
Yersinia pestis and Yersinia pseudotuberculosis. APMIS. 2009, 117 (1), pp.34-44.
5. Pham H V, Dang D T, Tran Minh N N et al. Correlates of environmental factors and human
plague: an ecological study in Vietnam. Int J Epidemiol. 2009, 38 (6), pp.1634-1641.
6. Radnedge L, Agron P G, Worsham P L et al. Genome plasticity in Yersinia pestis.
Microbiology. 2002, 148 (Pt 6), pp.1687-1698.
7. Radnedge L, Gamez-Chin S, McCready P M et al. Identification of nucleotide sequences for
the specific and rapid detection of Yersinia pestis. Appl Environ Microbiol. 2001, 67 (8),
pp.3759-3762.
8. Rollins S E, Rollins S M, Ryan E T. Yersinia pestis and the plague. Am J Clin Pathol.
2003, 119 Suppl, pp. S78-85.
9. Thoerner P, Bin Kingombe C I, Bogli-Stuber K et al. PCR detection of virulence genes in
Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene
distribution. Appl Environ Microbiol. 2003, 69 (3), pp.1810-1816.
10. Zhou D, Han Y, Dai E et al. Identification of signature genes for rapid and specific
characterization of Yersinia pestis. Microbiol Immunol. 2004, 48 (4), pp.263-269.

63


TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015

64



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×